figure out what your sequence is from the hash
hash2seq.pl: brute forces a sequence given a reference sequence and a hash
Usage: hash2seq.pl [options] ref.fasta hash1 [hash2...]
NOTE: ref.fasta nucleotides will be transformed into uppercase for hashing.
--quick-stop Stop if the hash was found. Assume no collisions.
This hasn't been benchmarked, but I assume it is faster.
--max-snps Max num of SNPs to mutate away from the reference sequence
Default: 3
--print-all Print all combinations of sequences with their hashes
and then exit.
--help This useful help menu
$ perl scripts/hash2seq.pl --max-snps 1 t/senterica/aroC.tfa d85fab85b29a8c26f89a4a3b46ec36a6
d85fab85b29a8c26f89a4a3b46ec36a6 GTTTTTCGCCCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGCGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACTTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTCTTTTGCGCCGATGCGGACAAACTTGACGCGCTGGACGAACTGATGCGCGCGCTGAAAAAAGAGGGTGACTCCATCGGCGCGAAAGTGACGGTGATGGCGAGCGGCGTGCCGGCAGGGCTTGGCGAACCGGTATTTGACCGACTGGATGCGGACATCGCCCATGCGCTGATGAGCATCAATGCGGTGAAAGGCGTGGAGATCGGCGAAGGATTTAACGTGGTGGCGCTGCGCGGCAGCCAGAATCGCGATGAAATCACGGCGCAGGGT