cutadapt -b crashes

[marcelm]

From modockes...@gmail.com on April 02, 2012 21:09:35

cutadapt -b GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 6_cutadap_trim_2.fastq -o recut_o -r recut_r --untrimmed-output=recut_untrim

Traceback (most recent call last):
File "/home/kesner/bin/python/bin/cutadapt", line 708, in
sys.exit(main())
File "/home/kesner/bin/python/bin/cutadapt", line 657, in main
for read in reader:
File "/home/kesner/bin/python/lib/python2.7/site-packages/cutadapt/seqio.py", line 249, in iter
raise ValueError("Length of quality sequence and length of read do not match (%d+%d!=%d)" % (len(qualities), lengthdiff, len(sequence)))
ValueError: Length of quality sequence and length of read do not match (22+0!=45) What version of the product are you using? On what operating system? on redhat linux. Only crashes with -b option so far

python 2.7.2

Ran fine for most of data

Original issue: http://code.google.com/p/cutadapt/issues/detail?id=40

[marcelm]

From modockes...@gmail.com on April 02, 2012 12:52:23

Probably my problem! Ignore this

[marcelm]

From marcel.m...@tu-dortmund.de on April 02, 2012 23:27:09

Perhaps I should make those error messages a little more obvious. It is -- as you seem to have guessed yourself -- an error message that points to an error in the input files, not to a crash in cutadapt.

I'll close this bug report then. Please open a new issue if you find another problem.

Status: Invalid