You signed in with another tab or window. Reload to refresh your session.You signed out in another tab or window. Reload to refresh your session.You switched accounts on another tab or window. Reload to refresh your session.Dismiss alert
Traceback (most recent call last):
File "/home/kesner/bin/python/bin/cutadapt", line 708, in
sys.exit(main())
File "/home/kesner/bin/python/bin/cutadapt", line 657, in main
for read in reader:
File "/home/kesner/bin/python/lib/python2.7/site-packages/cutadapt/seqio.py", line 249, in iter
raise ValueError("Length of quality sequence and length of read do not match (%d+%d!=%d)" % (len(qualities), lengthdiff, len(sequence)))
ValueError: Length of quality sequence and length of read do not match (22+0!=45) What version of the product are you using? On what operating system? on redhat linux. Only crashes with -b option so far
Perhaps I should make those error messages a little more obvious. It is -- as you seem to have guessed yourself -- an error message that points to an error in the input files, not to a crash in cutadapt.
I'll close this bug report then. Please open a new issue if you find another problem.
From modockes...@gmail.com on April 02, 2012 21:09:35
cutadapt -b GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 6_cutadap_trim_2.fastq -o recut_o -r recut_r --untrimmed-output=recut_untrim
Traceback (most recent call last):
File "/home/kesner/bin/python/bin/cutadapt", line 708, in
sys.exit(main())
File "/home/kesner/bin/python/bin/cutadapt", line 657, in main
for read in reader:
File "/home/kesner/bin/python/lib/python2.7/site-packages/cutadapt/seqio.py", line 249, in iter
raise ValueError("Length of quality sequence and length of read do not match (%d+%d!=%d)" % (len(qualities), lengthdiff, len(sequence)))
ValueError: Length of quality sequence and length of read do not match (22+0!=45) What version of the product are you using? On what operating system? on redhat linux. Only crashes with -b option so far
python 2.7.2
Ran fine for most of data
Original issue: http://code.google.com/p/cutadapt/issues/detail?id=40
The text was updated successfully, but these errors were encountered: