Addressing minimap sanitiser fail

nanoporetech · Jan 17, 2024 · 3b2986b · 3b2986b
1 parent baa4051
commit 3b2986b
Showing 1 changed file with 5 additions and 4 deletions.
diff --git a/tests/RealignMovesTest.cpp b/tests/RealignMovesTest.cpp
@@ -9,11 +9,12 @@ using namespace dorado;
 #define TEST_GROUP "[utils][realign_moves]"
 
 TEST_CASE("Realign Moves No Error", TEST_GROUP) {
-    std::string query_sequence = "ACGTACGTACGTACGT";   // Example query sequence
-    std::string target_sequence = "ACGTACGTACGTACGT";  // Example target sequence
+    std::string query_sequence = "ACGTACGTACGTACGTACGTACGTACGTACGT";   // Example query sequence
+    std::string target_sequence = "ACGTACGTACGTACGTACGTACGTACGTACGT";  // Example target sequence
     std::vector<uint8_t> moves = {
-            1, 0, 1, 0, 1, 0, 0, 1, 1, 0, 1, 0, 1, 0, 0, 1,
-            1, 0, 1, 0, 1, 0, 0, 1, 1, 0, 1, 0, 1, 0, 0, 1};  // Example moves vector
+            1, 0, 1, 0, 1, 0, 0, 1, 1, 0, 1, 0, 1, 0, 0, 1, 1, 0, 1, 0, 1, 0,
+            0, 1, 1, 0, 1, 0, 1, 0, 0, 1, 1, 0, 1, 0, 1, 0, 0, 1, 1, 0, 1, 0,
+            1, 0, 0, 1, 1, 0, 1, 0, 1, 0, 0, 1, 1, 0, 1, 0, 1, 0, 0, 1};  // Example moves vector
 
     // Test that calling realign_moves does not throw any exceptions
     CHECK_NOTHROW(utils::realign_moves(query_sequence, target_sequence, moves));