-
Notifications
You must be signed in to change notification settings - Fork 53
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Merge branch 'mvella/fix-mod-duplex-segv' into 'master'
Fix hemimethylation segfault See merge request machine-learning/dorado!800
- Loading branch information
Showing
5 changed files
with
64 additions
and
0 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,21 @@ | ||
#include "utils/sequence_utils.h" | ||
|
||
#include <ATen/ATen.h> | ||
#include <catch2/catch.hpp> | ||
|
||
using Slice = at::indexing::Slice; | ||
using namespace dorado; | ||
|
||
#define TEST_GROUP "[utils][realign_moves]" | ||
|
||
TEST_CASE("Realign Moves No Error", TEST_GROUP) { | ||
std::string query_sequence = "ACGTACGTACGTACGTACGTACGTACGTACGT"; // Example query sequence | ||
std::string target_sequence = "ACGTACGTACGTACGTACGTACGTACGTACGT"; // Example target sequence | ||
std::vector<uint8_t> moves = { | ||
1, 0, 1, 0, 1, 0, 0, 1, 1, 0, 1, 0, 1, 0, 0, 1, 1, 0, 1, 0, 1, 0, | ||
0, 1, 1, 0, 1, 0, 1, 0, 0, 1, 1, 0, 1, 0, 1, 0, 0, 1, 1, 0, 1, 0, | ||
1, 0, 0, 1, 1, 0, 1, 0, 1, 0, 0, 1, 1, 0, 1, 0, 1, 0, 0, 1}; // Example moves vector | ||
|
||
// Test that calling realign_moves does not throw any exceptions | ||
CHECK_NOTHROW(utils::realign_moves(query_sequence, target_sequence, moves)); | ||
} |