ERROR: local variable 'processed_output_filename' referenced before assignment #72
Comments
|
Hi wendy 517, I think this should be fixed in the latest version (2.1). Please reopen if you still run into issues. |
kclem
pushed a commit
that referenced
this issue
May 9, 2024
* Sam/try plots (#71) * Fix batch mode pandas warning. (#70) * refactor to call method on DataFrame, rather than Series. Removes warning. * Fix pandas future warning in CRISPRessoWGS --------- Co-authored-by: Cole Lyman <cole@colelyman.com> * Functional * Cole/fix status file name (#69) * Update config file logging messages This removes printing the exception (which is essentially a duplicate), and adds a condition if no config file was provided. Also changes `json` to `config` so that it is more clear. * Fix divide by zero when no amplicons are present in Batch mode * Don't append file_prefix to status file name * Place status files in output directories * Update tests branch for file_prefix addition * Load D3 and plotly figures with pro with multiple amplicons * Update batch * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix Before this fix, when using a file_prefix the second run that was compared would not be displayed as a data in the first figure of the report. * Import CRISPRessoPro instead of importing the version When installed via conda, the version is not available * Remove `get_amplicon_output` unused function from CRISPRessoCompare Also remove unused argparse import * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests * Allow for matching of multiple guides in the same amplicon * Fix pandas FutureWarning * Change test branch back to master --------- Co-authored-by: Sam <snic9004@gmail.com> * Try catch all futures * Fix test fail plots * Point test to try-plots * Fix d3 not showing and plotly mixing with matplotlib * Use logger for warnings and debug statements * Point tests back at master --------- Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com> Co-authored-by: Cole Lyman <cole@colelyman.com> * Sam/fix plots (#72) * Fix batch mode pandas warning. (#70) * refactor to call method on DataFrame, rather than Series. Removes warning. * Fix pandas future warning in CRISPRessoWGS --------- Co-authored-by: Cole Lyman <cole@colelyman.com> * Functional * Cole/fix status file name (#69) * Update config file logging messages This removes printing the exception (which is essentially a duplicate), and adds a condition if no config file was provided. Also changes `json` to `config` so that it is more clear. * Fix divide by zero when no amplicons are present in Batch mode * Don't append file_prefix to status file name * Place status files in output directories * Update tests branch for file_prefix addition * Load D3 and plotly figures with pro with multiple amplicons * Update batch * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix Before this fix, when using a file_prefix the second run that was compared would not be displayed as a data in the first figure of the report. * Import CRISPRessoPro instead of importing the version When installed via conda, the version is not available * Remove `get_amplicon_output` unused function from CRISPRessoCompare Also remove unused argparse import * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests * Allow for matching of multiple guides in the same amplicon * Fix pandas FutureWarning * Change test branch back to master --------- Co-authored-by: Sam <snic9004@gmail.com> * Try catch all futures * Fix test fail plots * Fix d3 not showing and plotly mixing with matplotlib --------- Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com> Co-authored-by: Cole Lyman <cole@colelyman.com> * Remove token from integration tests file --------- Co-authored-by: Samuel Nichols <Snic9004@gmail.com> Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
kclem
pushed a commit
that referenced
this issue
May 13, 2024
* Passing sgRNA sequences to regular and Batch D3 plots (#73) * Sam/try plots (#71) * Fix batch mode pandas warning. (#70) * refactor to call method on DataFrame, rather than Series. Removes warning. * Fix pandas future warning in CRISPRessoWGS --------- Co-authored-by: Cole Lyman <cole@colelyman.com> * Functional * Cole/fix status file name (#69) * Update config file logging messages This removes printing the exception (which is essentially a duplicate), and adds a condition if no config file was provided. Also changes `json` to `config` so that it is more clear. * Fix divide by zero when no amplicons are present in Batch mode * Don't append file_prefix to status file name * Place status files in output directories * Update tests branch for file_prefix addition * Load D3 and plotly figures with pro with multiple amplicons * Update batch * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix Before this fix, when using a file_prefix the second run that was compared would not be displayed as a data in the first figure of the report. * Import CRISPRessoPro instead of importing the version When installed via conda, the version is not available * Remove `get_amplicon_output` unused function from CRISPRessoCompare Also remove unused argparse import * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests * Allow for matching of multiple guides in the same amplicon * Fix pandas FutureWarning * Change test branch back to master --------- Co-authored-by: Sam <snic9004@gmail.com> * Try catch all futures * Fix test fail plots * Point test to try-plots * Fix d3 not showing and plotly mixing with matplotlib * Use logger for warnings and debug statements * Point tests back at master --------- Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com> Co-authored-by: Cole Lyman <cole@colelyman.com> * Sam/fix plots (#72) * Fix batch mode pandas warning. (#70) * refactor to call method on DataFrame, rather than Series. Removes warning. * Fix pandas future warning in CRISPRessoWGS --------- Co-authored-by: Cole Lyman <cole@colelyman.com> * Functional * Cole/fix status file name (#69) * Update config file logging messages This removes printing the exception (which is essentially a duplicate), and adds a condition if no config file was provided. Also changes `json` to `config` so that it is more clear. * Fix divide by zero when no amplicons are present in Batch mode * Don't append file_prefix to status file name * Place status files in output directories * Update tests branch for file_prefix addition * Load D3 and plotly figures with pro with multiple amplicons * Update batch * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix Before this fix, when using a file_prefix the second run that was compared would not be displayed as a data in the first figure of the report. * Import CRISPRessoPro instead of importing the version When installed via conda, the version is not available * Remove `get_amplicon_output` unused function from CRISPRessoCompare Also remove unused argparse import * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests * Allow for matching of multiple guides in the same amplicon * Fix pandas FutureWarning * Change test branch back to master --------- Co-authored-by: Sam <snic9004@gmail.com> * Try catch all futures * Fix test fail plots * Fix d3 not showing and plotly mixing with matplotlib --------- Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com> Co-authored-by: Cole Lyman <cole@colelyman.com> * Remove token from integration tests file * Provide sgRNA_sequences to plot_nucleotide_quilt plots * Passing sgRNA_sequences to plot * Refactor check for determining when to use CRISPREssoPro or matplotlib for Batch plots * Add max-height to Batch report samples * Change testing branch * Fix wrong check for large Batch plots * Update integration_tests.yml to point back at master --------- Co-authored-by: Samuel Nichols <Snic9004@gmail.com> Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com> Co-authored-by: Cole Lyman <cole@colelyman.com> * Push new releases to ECR (#74) * Create aws_ecr.yml (#1) * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * us-east-1 * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Fix d3 sgRNA sequences (#76) * Pass correct sgRNA_sequences to d3 plot * Pass correct sgRNA sequence to prime editor plot for d3 * Resize plotly (#75) * Sam/try plots (#71) * Fix batch mode pandas warning. (#70) * refactor to call method on DataFrame, rather than Series. Removes warning. * Fix pandas future warning in CRISPRessoWGS --------- Co-authored-by: Cole Lyman <cole@colelyman.com> * Functional * Cole/fix status file name (#69) * Update config file logging messages This removes printing the exception (which is essentially a duplicate), and adds a condition if no config file was provided. Also changes `json` to `config` so that it is more clear. * Fix divide by zero when no amplicons are present in Batch mode * Don't append file_prefix to status file name * Place status files in output directories * Update tests branch for file_prefix addition * Load D3 and plotly figures with pro with multiple amplicons * Update batch * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix Before this fix, when using a file_prefix the second run that was compared would not be displayed as a data in the first figure of the report. * Import CRISPRessoPro instead of importing the version When installed via conda, the version is not available * Remove `get_amplicon_output` unused function from CRISPRessoCompare Also remove unused argparse import * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests * Allow for matching of multiple guides in the same amplicon * Fix pandas FutureWarning * Change test branch back to master --------- Co-authored-by: Sam <snic9004@gmail.com> * Try catch all futures * Fix test fail plots * Point test to try-plots * Fix d3 not showing and plotly mixing with matplotlib * Use logger for warnings and debug statements * Point tests back at master --------- Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com> Co-authored-by: Cole Lyman <cole@colelyman.com> * Sam/fix plots (#72) * Fix batch mode pandas warning. (#70) * refactor to call method on DataFrame, rather than Series. Removes warning. * Fix pandas future warning in CRISPRessoWGS --------- Co-authored-by: Cole Lyman <cole@colelyman.com> * Functional * Cole/fix status file name (#69) * Update config file logging messages This removes printing the exception (which is essentially a duplicate), and adds a condition if no config file was provided. Also changes `json` to `config` so that it is more clear. * Fix divide by zero when no amplicons are present in Batch mode * Don't append file_prefix to status file name * Place status files in output directories * Update tests branch for file_prefix addition * Load D3 and plotly figures with pro with multiple amplicons * Update batch * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix Before this fix, when using a file_prefix the second run that was compared would not be displayed as a data in the first figure of the report. * Import CRISPRessoPro instead of importing the version When installed via conda, the version is not available * Remove `get_amplicon_output` unused function from CRISPRessoCompare Also remove unused argparse import * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests * Allow for matching of multiple guides in the same amplicon * Fix pandas FutureWarning * Change test branch back to master --------- Co-authored-by: Sam <snic9004@gmail.com> * Try catch all futures * Fix test fail plots * Fix d3 not showing and plotly mixing with matplotlib --------- Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com> Co-authored-by: Cole Lyman <cole@colelyman.com> * Remove token from integration tests file * Pass div id for plotly * Remove debug --------- Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com> Co-authored-by: Cole Lyman <cole@colelyman.com> --------- Co-authored-by: Trevor Martin <60452953+trevormartinj7@users.noreply.github.com> Co-authored-by: Samuel Nichols <Snic9004@gmail.com> Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment
Describe the bug
ERROR: local variable 'processed_output_filename' referenced before assignment.
This problem appeared when using "--bam_input".
Expected behavior
I want to use pre-aligned bam file instead of raw fastq file to run CRISPResso2 but failed.
To reproduce
CRISPResso --bam_input ../19R852_egfp/19R852_egfp.pairmap.q30.sorted.rmdup.bam -a GTGAAGTTCGAGGGCGACGCCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACA -an egfp_337_559 -g AACGTCTATA -gn CU3.0 -o ../data/5_CRISPResso --plot_window_size 30 --quantification_window_center +2 --conversion_nuc_from C --conversion_nuc_to T --place_report_in_output_folder --exclude_bp_from_left 6 --exclude_bp_from_right 6 --bam_chr_loc egfp:337-559 --debug
Debug output
Traceback (most recent call last):
File "../miniconda2/envs/crispresso2_env/lib/python2.7/site-packages/CRISPResso2/CRISPRessoCORE.py", line 1989, in main
aln_stats = process_fastq(processed_output_filename,variantCache,ref_names,refs,args)
UnboundLocalError: local variable 'processed_output_filename' referenced before assignment
CRITICAL @ Fri, 22 Jan 2021 16:11:21:
Traceback (most recent call last):
File "../miniconda2/envs/crispresso2_env/lib/python2.7/site-packages/CRISPResso2/CRISPRessoCORE.py", line 1989, in main
aln_stats = process_fastq(processed_output_filename,variantCache,ref_names,refs,args)
UnboundLocalError: local variable 'processed_output_filename' referenced before assignment
The text was updated successfully, but these errors were encountered: