-
Notifications
You must be signed in to change notification settings - Fork 89
New issue
Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.
By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.
Already on GitHub? Sign in to your account
ERROR: local variable 'processed_output_filename' referenced before assignment #72
Comments
Hi wendy 517, I think this should be fixed in the latest version (2.1). Please reopen if you still run into issues. |
kclem
pushed a commit
that referenced
this issue
May 9, 2024
* Sam/try plots (#71) * Fix batch mode pandas warning. (#70) * refactor to call method on DataFrame, rather than Series. Removes warning. * Fix pandas future warning in CRISPRessoWGS --------- Co-authored-by: Cole Lyman <cole@colelyman.com> * Functional * Cole/fix status file name (#69) * Update config file logging messages This removes printing the exception (which is essentially a duplicate), and adds a condition if no config file was provided. Also changes `json` to `config` so that it is more clear. * Fix divide by zero when no amplicons are present in Batch mode * Don't append file_prefix to status file name * Place status files in output directories * Update tests branch for file_prefix addition * Load D3 and plotly figures with pro with multiple amplicons * Update batch * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix Before this fix, when using a file_prefix the second run that was compared would not be displayed as a data in the first figure of the report. * Import CRISPRessoPro instead of importing the version When installed via conda, the version is not available * Remove `get_amplicon_output` unused function from CRISPRessoCompare Also remove unused argparse import * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests * Allow for matching of multiple guides in the same amplicon * Fix pandas FutureWarning * Change test branch back to master --------- Co-authored-by: Sam <snic9004@gmail.com> * Try catch all futures * Fix test fail plots * Point test to try-plots * Fix d3 not showing and plotly mixing with matplotlib * Use logger for warnings and debug statements * Point tests back at master --------- Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com> Co-authored-by: Cole Lyman <cole@colelyman.com> * Sam/fix plots (#72) * Fix batch mode pandas warning. (#70) * refactor to call method on DataFrame, rather than Series. Removes warning. * Fix pandas future warning in CRISPRessoWGS --------- Co-authored-by: Cole Lyman <cole@colelyman.com> * Functional * Cole/fix status file name (#69) * Update config file logging messages This removes printing the exception (which is essentially a duplicate), and adds a condition if no config file was provided. Also changes `json` to `config` so that it is more clear. * Fix divide by zero when no amplicons are present in Batch mode * Don't append file_prefix to status file name * Place status files in output directories * Update tests branch for file_prefix addition * Load D3 and plotly figures with pro with multiple amplicons * Update batch * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix Before this fix, when using a file_prefix the second run that was compared would not be displayed as a data in the first figure of the report. * Import CRISPRessoPro instead of importing the version When installed via conda, the version is not available * Remove `get_amplicon_output` unused function from CRISPRessoCompare Also remove unused argparse import * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests * Allow for matching of multiple guides in the same amplicon * Fix pandas FutureWarning * Change test branch back to master --------- Co-authored-by: Sam <snic9004@gmail.com> * Try catch all futures * Fix test fail plots * Fix d3 not showing and plotly mixing with matplotlib --------- Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com> Co-authored-by: Cole Lyman <cole@colelyman.com> * Remove token from integration tests file --------- Co-authored-by: Samuel Nichols <Snic9004@gmail.com> Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
kclem
pushed a commit
that referenced
this issue
May 13, 2024
* Passing sgRNA sequences to regular and Batch D3 plots (#73) * Sam/try plots (#71) * Fix batch mode pandas warning. (#70) * refactor to call method on DataFrame, rather than Series. Removes warning. * Fix pandas future warning in CRISPRessoWGS --------- Co-authored-by: Cole Lyman <cole@colelyman.com> * Functional * Cole/fix status file name (#69) * Update config file logging messages This removes printing the exception (which is essentially a duplicate), and adds a condition if no config file was provided. Also changes `json` to `config` so that it is more clear. * Fix divide by zero when no amplicons are present in Batch mode * Don't append file_prefix to status file name * Place status files in output directories * Update tests branch for file_prefix addition * Load D3 and plotly figures with pro with multiple amplicons * Update batch * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix Before this fix, when using a file_prefix the second run that was compared would not be displayed as a data in the first figure of the report. * Import CRISPRessoPro instead of importing the version When installed via conda, the version is not available * Remove `get_amplicon_output` unused function from CRISPRessoCompare Also remove unused argparse import * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests * Allow for matching of multiple guides in the same amplicon * Fix pandas FutureWarning * Change test branch back to master --------- Co-authored-by: Sam <snic9004@gmail.com> * Try catch all futures * Fix test fail plots * Point test to try-plots * Fix d3 not showing and plotly mixing with matplotlib * Use logger for warnings and debug statements * Point tests back at master --------- Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com> Co-authored-by: Cole Lyman <cole@colelyman.com> * Sam/fix plots (#72) * Fix batch mode pandas warning. (#70) * refactor to call method on DataFrame, rather than Series. Removes warning. * Fix pandas future warning in CRISPRessoWGS --------- Co-authored-by: Cole Lyman <cole@colelyman.com> * Functional * Cole/fix status file name (#69) * Update config file logging messages This removes printing the exception (which is essentially a duplicate), and adds a condition if no config file was provided. Also changes `json` to `config` so that it is more clear. * Fix divide by zero when no amplicons are present in Batch mode * Don't append file_prefix to status file name * Place status files in output directories * Update tests branch for file_prefix addition * Load D3 and plotly figures with pro with multiple amplicons * Update batch * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix Before this fix, when using a file_prefix the second run that was compared would not be displayed as a data in the first figure of the report. * Import CRISPRessoPro instead of importing the version When installed via conda, the version is not available * Remove `get_amplicon_output` unused function from CRISPRessoCompare Also remove unused argparse import * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests * Allow for matching of multiple guides in the same amplicon * Fix pandas FutureWarning * Change test branch back to master --------- Co-authored-by: Sam <snic9004@gmail.com> * Try catch all futures * Fix test fail plots * Fix d3 not showing and plotly mixing with matplotlib --------- Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com> Co-authored-by: Cole Lyman <cole@colelyman.com> * Remove token from integration tests file * Provide sgRNA_sequences to plot_nucleotide_quilt plots * Passing sgRNA_sequences to plot * Refactor check for determining when to use CRISPREssoPro or matplotlib for Batch plots * Add max-height to Batch report samples * Change testing branch * Fix wrong check for large Batch plots * Update integration_tests.yml to point back at master --------- Co-authored-by: Samuel Nichols <Snic9004@gmail.com> Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com> Co-authored-by: Cole Lyman <cole@colelyman.com> * Push new releases to ECR (#74) * Create aws_ecr.yml (#1) * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * us-east-1 * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Update aws_ecr.yml * Fix d3 sgRNA sequences (#76) * Pass correct sgRNA_sequences to d3 plot * Pass correct sgRNA sequence to prime editor plot for d3 * Resize plotly (#75) * Sam/try plots (#71) * Fix batch mode pandas warning. (#70) * refactor to call method on DataFrame, rather than Series. Removes warning. * Fix pandas future warning in CRISPRessoWGS --------- Co-authored-by: Cole Lyman <cole@colelyman.com> * Functional * Cole/fix status file name (#69) * Update config file logging messages This removes printing the exception (which is essentially a duplicate), and adds a condition if no config file was provided. Also changes `json` to `config` so that it is more clear. * Fix divide by zero when no amplicons are present in Batch mode * Don't append file_prefix to status file name * Place status files in output directories * Update tests branch for file_prefix addition * Load D3 and plotly figures with pro with multiple amplicons * Update batch * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix Before this fix, when using a file_prefix the second run that was compared would not be displayed as a data in the first figure of the report. * Import CRISPRessoPro instead of importing the version When installed via conda, the version is not available * Remove `get_amplicon_output` unused function from CRISPRessoCompare Also remove unused argparse import * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests * Allow for matching of multiple guides in the same amplicon * Fix pandas FutureWarning * Change test branch back to master --------- Co-authored-by: Sam <snic9004@gmail.com> * Try catch all futures * Fix test fail plots * Point test to try-plots * Fix d3 not showing and plotly mixing with matplotlib * Use logger for warnings and debug statements * Point tests back at master --------- Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com> Co-authored-by: Cole Lyman <cole@colelyman.com> * Sam/fix plots (#72) * Fix batch mode pandas warning. (#70) * refactor to call method on DataFrame, rather than Series. Removes warning. * Fix pandas future warning in CRISPRessoWGS --------- Co-authored-by: Cole Lyman <cole@colelyman.com> * Functional * Cole/fix status file name (#69) * Update config file logging messages This removes printing the exception (which is essentially a duplicate), and adds a condition if no config file was provided. Also changes `json` to `config` so that it is more clear. * Fix divide by zero when no amplicons are present in Batch mode * Don't append file_prefix to status file name * Place status files in output directories * Update tests branch for file_prefix addition * Load D3 and plotly figures with pro with multiple amplicons * Update batch * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix Before this fix, when using a file_prefix the second run that was compared would not be displayed as a data in the first figure of the report. * Import CRISPRessoPro instead of importing the version When installed via conda, the version is not available * Remove `get_amplicon_output` unused function from CRISPRessoCompare Also remove unused argparse import * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests * Allow for matching of multiple guides in the same amplicon * Fix pandas FutureWarning * Change test branch back to master --------- Co-authored-by: Sam <snic9004@gmail.com> * Try catch all futures * Fix test fail plots * Fix d3 not showing and plotly mixing with matplotlib --------- Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com> Co-authored-by: Cole Lyman <cole@colelyman.com> * Remove token from integration tests file * Pass div id for plotly * Remove debug --------- Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com> Co-authored-by: Cole Lyman <cole@colelyman.com> --------- Co-authored-by: Trevor Martin <60452953+trevormartinj7@users.noreply.github.com> Co-authored-by: Samuel Nichols <Snic9004@gmail.com> Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment
Describe the bug
ERROR: local variable 'processed_output_filename' referenced before assignment.
This problem appeared when using "--bam_input".
Expected behavior
I want to use pre-aligned bam file instead of raw fastq file to run CRISPResso2 but failed.
To reproduce
CRISPResso --bam_input ../19R852_egfp/19R852_egfp.pairmap.q30.sorted.rmdup.bam -a GTGAAGTTCGAGGGCGACGCCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACA -an egfp_337_559 -g AACGTCTATA -gn CU3.0 -o ../data/5_CRISPResso --plot_window_size 30 --quantification_window_center +2 --conversion_nuc_from C --conversion_nuc_to T --place_report_in_output_folder --exclude_bp_from_left 6 --exclude_bp_from_right 6 --bam_chr_loc egfp:337-559 --debug
Debug output
Traceback (most recent call last):
File "../miniconda2/envs/crispresso2_env/lib/python2.7/site-packages/CRISPResso2/CRISPRessoCORE.py", line 1989, in main
aln_stats = process_fastq(processed_output_filename,variantCache,ref_names,refs,args)
UnboundLocalError: local variable 'processed_output_filename' referenced before assignment
CRITICAL @ Fri, 22 Jan 2021 16:11:21:
Traceback (most recent call last):
File "../miniconda2/envs/crispresso2_env/lib/python2.7/site-packages/CRISPResso2/CRISPRessoCORE.py", line 1989, in main
aln_stats = process_fastq(processed_output_filename,variantCache,ref_names,refs,args)
UnboundLocalError: local variable 'processed_output_filename' referenced before assignment
The text was updated successfully, but these errors were encountered: