-
Notifications
You must be signed in to change notification settings - Fork 89
New issue
Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.
By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.
Already on GitHub? Sign in to your account
minor bug fixes for plotCustomAllelePlot.py to work with Python3 #212
Merged
Conversation
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Contributor
dharjanto
commented
Apr 11, 2022
- pass plot_center as a parameter to plot_alleles_tables_from_folder and replace args.plot_center references in function accordingly
- substitute iteritems() with items() for insertion_dict.items().
Colelyman
pushed a commit
to edilytics/CRISPResso2
that referenced
this pull request
May 2, 2022
kclem
added a commit
that referenced
this pull request
May 4, 2022
* Squashed commit of the following: commit 8564eb0 Merge: f6ef62c 07cc7d8 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Jan 11 16:20:15 2022 -0500 Merge branch 'indel-alignment-fix' of https://github.com/edilytics/CRISPResso2 into indel-alignment-fix commit 07cc7d8 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:29:59 2021 -0700 Fix bug in `find_indels_substitutions` This bug occurred when there was a deletion at the end of a sequence, and was thus not properly accounted for. commit f6ef62c Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:29:59 2021 -0700 Fix bug in `find_indels_substitutions` This bug occurred when there was a deletion at the end of a sequence, and was thus not properly accounted for. commit 7212f87 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:26:17 2021 -0700 Add a unit test for `find_indels_substitutions` This unit test checks for deletions at the end of a sequence, which are inherently outside of the include_indx_set window. commit d50b4e9 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:03:22 2021 -0700 Fix a bug in `find_indels_substitutions` The bug that this commit fixes is when an insertion occurs at the edge of the include indexes. The trouble with this earlier was that it was using the `idx` to calculate the size of the insertion, but the `idx` wasn't being incremented anymore because it was outside of the include window. commit 4db066f Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:01:39 2021 -0700 Add test case for `find_indels_substitutions` This test case is extracted from the CRISPRessoBatch integration test and provides an example where there is an insertion at the edge of the include index. commit 3b3a741 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 11:37:07 2021 -0700 Fix bug in CRISPRessoCompare where sample names were not properly set This was a place where it was (partially) missed during the crispresso2_info object refactoring. commit e9f5eff Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:26:17 2021 -0700 Add a unit test for `find_indels_substitutions` This unit test checks for deletions at the end of a sequence, which are inherently outside of the include_indx_set window. commit d4d45a9 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:03:22 2021 -0700 Fix a bug in `find_indels_substitutions` The bug that this commit fixes is when an insertion occurs at the edge of the include indexes. The trouble with this earlier was that it was using the `idx` to calculate the size of the insertion, but the `idx` wasn't being incremented anymore because it was outside of the include window. commit 13f00bb Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:01:39 2021 -0700 Add test case for `find_indels_substitutions` This test case is extracted from the CRISPRessoBatch integration test and provides an example where there is an insertion at the edge of the include index. commit 659ae34 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 11:37:07 2021 -0700 Fix bug in CRISPRessoCompare where sample names were not properly set This was a place where it was (partially) missed during the crispresso2_info object refactoring. * Add parameter `--suppress_batch_summary_plots` If many runs are run at the same time, batch summary plots may fail because they are too large for matplotlib. This parameter `--suppress_batch_summary_plots` allows individual runs to be plotted, but suppresses batch summary plots that may otherwise be too big. * Pep formatting cleanup * Add summary nucleotide plots to aggregate * Aggregate plots are paginated * Update CRISPRessoAggregateCORE.py Remove max sample limit for plotting * Add --max_samples_per_summary_plot to CRISPRessoAggregate Parameterize the max number of samples to plot on each page of reports. Additional PDFs will be created with this number of samples on them. * Add plotly function to plot an interactive heatmap * Fix deprecated numpy type to suppress warning * Add plotting of heatmaps to CRISPRessoAggregateCORE to summarize modification types These heatmaps are interactive (zoomable and panable) and show for each sample the percentage of insertions, substitutions, and deletions. * Add the heatmap summaries to the CRISPRessoAggregate report * Update Bootstrap to 5.1.3 This is mainly so that we can use the fullscreen modal functionality in this version. * Move the plotly heatmaps to a Bootstrap modal * Fix bug where plots were not filling up entire modal. I have tried countless different ways for this to work, and this is the best that I can come up with. After the modal is opened it triggers the plot to resize, and then for some reason you need to trigger the resize event. I think this is because a `div` changing size won't actually trigger the resizing of the plot (and neither will just calling `Plotly.Plots.resize`...?!). * Update the axis labels and add autosize to plotly heatmaps I'm pretty sure the autosize doesn't do anything, but it is there for good measure. * Abandon attempts to make plots fullscreen This includes removing the Bootstrap modal (two out of the three plots would resize properly and I couldn't figure out a way to have the plot displayed outside of the modal). I have left in some javascript to make the plot fullscreen, but I couldn't get the formatting quite right and the plot wasn't much bigger in the fullscreen version because there was a ton of space between the plot and the heatmap. If some brave soul would like to tackle it, feel free! * Rename and refactor how plot data is passed around I have consolidated how the plot data is passed around, so that now you can pass in only one dict with all of the information instead of 4 or 5 separate parameters. I also renamed the `heatmap_plot_*` to `allele_modification_heatmap_*`. * Implement the line plot version of the modification percentages This also includes correctly resizing the plot when the line plot tab is selected! * Change default `max_samples_per_summary_plot` to be 150 instead of 250 * Remove extra assignments of `this_number_samples` and suppress plot The plot that is suppressed is the large nucleotide quilt when there is a large number of samples. Is it okay to suppress this plot @kclem? * Implement parallel plotting in CRISPRessoAggregate * Fix sample indexing error and heatmap scaling for large number of samples * Add parameter `--suppress_batch_summary_plots` If many runs are run at the same time, batch summary plots may fail because they are too large for matplotlib. This parameter `--suppress_batch_summary_plots` allows individual runs to be plotted, but suppresses batch summary plots that may otherwise be too big. * Pep formatting cleanup * Add summary nucleotide plots to aggregate * Aggregate plots are paginated * Update CRISPRessoAggregateCORE.py Remove max sample limit for plotting * Add --max_samples_per_summary_plot to CRISPRessoAggregate Parameterize the max number of samples to plot on each page of reports. Additional PDFs will be created with this number of samples on them. * Add plotly function to plot an interactive heatmap * Fix deprecated numpy type to suppress warning * Add plotting of heatmaps to CRISPRessoAggregateCORE to summarize modification types These heatmaps are interactive (zoomable and panable) and show for each sample the percentage of insertions, substitutions, and deletions. * Add the heatmap summaries to the CRISPRessoAggregate report * Update Bootstrap to 5.1.3 This is mainly so that we can use the fullscreen modal functionality in this version. * Move the plotly heatmaps to a Bootstrap modal * Fix bug where plots were not filling up entire modal. I have tried countless different ways for this to work, and this is the best that I can come up with. After the modal is opened it triggers the plot to resize, and then for some reason you need to trigger the resize event. I think this is because a `div` changing size won't actually trigger the resizing of the plot (and neither will just calling `Plotly.Plots.resize`...?!). * Update the axis labels and add autosize to plotly heatmaps I'm pretty sure the autosize doesn't do anything, but it is there for good measure. * Abandon attempts to make plots fullscreen This includes removing the Bootstrap modal (two out of the three plots would resize properly and I couldn't figure out a way to have the plot displayed outside of the modal). I have left in some javascript to make the plot fullscreen, but I couldn't get the formatting quite right and the plot wasn't much bigger in the fullscreen version because there was a ton of space between the plot and the heatmap. If some brave soul would like to tackle it, feel free! * Rename and refactor how plot data is passed around I have consolidated how the plot data is passed around, so that now you can pass in only one dict with all of the information instead of 4 or 5 separate parameters. I also renamed the `heatmap_plot_*` to `allele_modification_heatmap_*`. * Implement the line plot version of the modification percentages This also includes correctly resizing the plot when the line plot tab is selected! * Change default `max_samples_per_summary_plot` to be 150 instead of 250 * Remove extra assignments of `this_number_samples` and suppress plot The plot that is suppressed is the large nucleotide quilt when there is a large number of samples. Is it okay to suppress this plot @kclem? * Implement parallel plotting in CRISPRessoAggregate * Fix sample indexing error and heatmap scaling for large number of samples * Add plotly requrement to setup.py * Remove space around vertical barcharts * Add scrollbar to long images in multiReport * Fill in default (empty) values to allele modification plots When not running CRISPRessoAggregate, default values for the `allele_modification_heatmap_plot` and `allele_modification_lin_plot` dictionaries will be set so that the template can be properly rendered. * Include CRISPRessoBatch in the refactor of how summary_plot dicts are handled * Update dockerfile for new docker * minor bug fixes for plotCustomAllelePlot.py to work with Python3 (#212) * Allow for flexible parsing of quant window coordinates * CRISPRessoPooled debug flash command, fix pep formatting * Set flexiguide homology parameter type to int * Coerce ints in batch file checking (#200) * Batch type coerce and r2 file check * Revert "Batch type coerce and r2 file check" This reverts commit f917366. * Coerce int values * Handle multiple qwcs in batch mode If multiple qwcs were provided in batch mode, a parsing error would occur. This fixes this bug. * Fix bug from old pandas for int cols Evidently old pandas versions throw an error if a column doesn't exist. This checks to see if the column exists before the values are set. * Create allele modification heatmaps and line plots in CRISPRessoBatch * Add allele modification heatmaps and line plots to CRISPRessoBatch * Make all plots in CRISPRessoBatch run in parallel * Make `--suppress_batch_summary_plots` store true Also, only open and shutdown the process pool when necessary. * Add blank values for allele_modification entries when not present Co-authored-by: Kendell Clement <k.clement.dev@gmail.com> Co-authored-by: dharjanto <dewi.harjanto@gmail.com> Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
mbowcut2
added a commit
to edilytics/CRISPResso2
that referenced
this pull request
Feb 15, 2024
commit c909ea3b34e87ce637e00dac075d2bb2f8bfb954 Author: McKay <mbowcut@gmail.com> Date: Thu Feb 15 15:55:23 2024 -0700 added plotly dependency for pro commit 76b3601f6a0144f100266153f1c999e0c5de65de Author: Samuel Nichols <Snic9004@gmail.com> Date: Fri Jan 12 09:56:19 2024 -0700 Squashed commit of the following: commit 603f2eff9d1aa21ae95f3e134da303b8018d3a33 Author: Samuel Nichols <Snic9004@gmail.com> Date: Fri Jan 12 09:48:20 2024 -0700 fix guardrials partial commit 22fc03183a8070c30dfb74d5c23575ac19019855 Author: Samuel Nichols <Snic9004@gmail.com> Date: Fri Jan 12 08:54:01 2024 -0700 Add guardrail partial commit e55f6b21972b578261bc5a864ce1d653d98f9e34 Author: Samuel Nichols <Snic9004@gmail.com> Date: Mon Jan 8 07:50:59 2024 -0700 Functional guardrails, needs reports update commit 6e968e9699ed59a47d88191d03768e042d8b60a4 Merge: 32b49685 e948ce10 Author: Samuel Nichols <Snic9004@gmail.com> Date: Mon Dec 18 13:34:36 2023 -0700 Merge branch 'guardrails-clean-history' of https://github.com/edilytics/CRISPResso2 into guardrails-clean-history commit 32b49685da320501dad2b0ebbb57887b66220ba8 Author: Samuel Nichols <Snic9004@gmail.com> Date: Fri Dec 15 15:27:04 2023 -0700 Include guardrail functions commit 4e309cf6f732565d635de3d4c5d074ada3027e2d Author: Cole Lyman <cole@colelyman.com> Date: Mon Dec 18 10:51:55 2023 -0700 Refactor to use CRISPRessoReports module commit e648dc087c0055bc5d2fca13c64071a371dea941 Author: Cole Lyman <cole@colelyman.com> Date: Mon Dec 18 10:51:11 2023 -0700 Add CRISPRessoReports subtree commit e948ce107ebb0d1d99010ed12e937f34b5e607d4 Author: Samuel Nichols <Snic9004@gmail.com> Date: Fri Dec 15 15:27:04 2023 -0700 Include guardrail functions commit d33c748871a625facfe8d792e29c77ab9779138f Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Nov 7 16:31:06 2023 -0700 Include parameter --assign_ambiguous_alignments_to_first_reference in readme commit a1435f7f491a6a61434f3051e39f39a4c9bf1edc Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed Oct 11 17:17:30 2023 -0600 Enable quantification by sgRNA (#348) This PR includes: - storing the sgRNA-specific editing locations in the crispresso2_info object. Previously, each amplicon would record the indices of quantification windows across the guide, but not for individual guides. This stores the information for each guide in crispresso2_info['results']['refs'][reference_name]['sgRNA_include_idxs'] - a script (count_sgRNA_specific_edits.py) to parse through an allele table output from a completed CRISPResso run (`--write_detailed_allele_table` flag required) to count edits in each sgRNA separately. I don't have a good double-edited sample handy, but it can be run on the demo HDR data [hdr.fastq.gz](http://crispresso.pinellolab.org/static/demo/hdr.fastq.gz) using the command: ``` CRISPResso -r1 hdr.fastq.gz -a acatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgTggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttggtatcaaggtta -e acatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcaCctgactccGgaggagaagtctgccgttactgcGctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttggtatcaaggtta -c atggtgcatctgactcctgTggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcag -g TGCACCATGGTGTCTGTTTG,GATGAAGTTGGTGGTGAGGCCC --write_detailed_allele_table -n hdr3 -p max -gn guide1,guide2 ``` ``` python CRISPResso2/scripts/count_sgRNA_specific_edits.py -f CRISPResso_on_hdr3 ``` This produces: ``` Processed 25000 alleles Reference: Reference (2391/23415 modified reads) UNMODIFIED: 21024 MODIFIED guide1: 2359 MODIFIED guide2: 32 Reference: HDR (856/1577 modified reads) UNMODIFIED: 721 MODIFIED guide1: 854 MODIFIED guide1 + guide2: 1 MODIFIED guide2: 1 ``` commit 2e3da02fdbed2fa8ae02a277763d65a502459827 Author: Cole Lyman <Cole@colelyman.com> Date: Tue Oct 10 15:29:08 2023 -0600 changed tuple to list for matplotlib change (#31) (#346) Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com> commit cd3c332135fe4db0f9218e3d87263d5c65838ed9 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sun Oct 1 01:54:46 2023 -0600 rename script to camel case commit 7c719d65fb36ac7654db9040f226564ea28fcab9 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sun Oct 1 01:53:44 2023 -0600 Add new script for counting high quality bases commit f97cd2795e89464bcc9321ccfdbca3e6af2bcb4f Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Sep 14 15:15:30 2023 -0600 Prime editing alignment params (#336) Adds two parameters to control alignment of pegRNA components: --prime_editing_gap_open_penalty and --prime_editing_gap_extend_penalty. CRISPResso checks to see whether the pegRNA spacer and extension sequence are in the correct orientation, but sometimes they could align in the incorrect orientation with a higher score (e.g. via insertion of multiple gaps, whereas a single long gap would be preferred). Introducing these two parameters allows users to adjust the alignment parameters specifically for these prime-editing checks without adjusting the global alignment parameters which will be applied to reads that are aligned to the WT reference/prime-editing reference sequences. The new prime_editing_gap_open_penalty is set to -50, a higher gap open penalty than the default needleman_wunsch_gap_open penalty (-20). This commit breaks backward-reproducibility, but mostly in the checking of pegRNA component orientation - so previously some CRISPResso runs would have failed and produced an error, but now they will (hopefully) succeed. To achieve complete backward reproducibility, add the flag --prime_editing_gap_open_penalty -20 to runs. commit 64cbf36dae85cffa2c15e73f2a7ee8aa1077d917 Author: Cole Lyman <Cole@colelyman.com> Date: Thu Sep 7 16:43:30 2023 -0600 Fix samtools piping (#325) * Remove samtools pipe stderr to stdout Sometimes some of the libraries that samtools depends on don't have the correct version information, and as such samtools will report this to stderr when run. Because we pipe the output of samtools, we expect it to be valid SAM format, but when these library version messages are reported, it breaks CRISPRessoWGS. * Remove extra spacing at end of lines and add missing comma in WGS * Log stderr from samtools in CRISPRessoWGS commit 8feff4101f27406d9d88ace97d31a518276bff3f Author: Cole Lyman <Cole@colelyman.com> Date: Fri Sep 1 09:43:56 2023 -0600 Replace link to CRISPResso schematic with raw URL in README (#329) * Replace link to CRISPResso schematic with raw URL * Add new lines to the beginning of unordered lists commit 2e9e6bff5bcc536d5e2ba1440d1ab96d9d47efd6 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Aug 10 00:52:12 2023 -0600 Try to unbreak CircleCI commit ae5b95246cb0f6d66c4cbfb50cf8f5a9626b0827 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Aug 10 00:17:27 2023 -0600 Center command line text messages commit 4d9c71ecf2248c9bb1e10430178dc318b6621c8b Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Aug 10 00:17:07 2023 -0600 Fix bug in prime-editing scaffold-incorporation plotting If read is too short, scaffold incorporation detection will fail because it will check beyond the length of the read. commit 2b36a1a5c35e8a93516ce8baf464595615e0f402 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed Aug 9 15:29:48 2023 -0600 CRISPRessoPooled --compile_postrun_references bug fixes commit 3e04d1d402bcf95edd39fc7c8c9af61bb380f9db Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Aug 8 23:30:15 2023 -0600 Fix missing ' in Pooled --demultiplex_only_at_amplicons commit 06af527f9e2020c5cf251e7f1cec0b1eca1c1664 Author: Cole Lyman <Cole@colelyman.com> Date: Mon Jul 24 10:47:46 2023 -0600 Sort pandas dataframes by # of reads and sequences so that the order is consistent (#316) * Make sorting stable * Including c files * Sort by #Reads instead of %Reads to avoid floating point errors --------- Co-authored-by: Samuel Nichols <Snic9004@gmail.com> commit de05533b3511a84f3b6b14fc2ef64db041613261 Author: Cole Lyman <Cole@colelyman.com> Date: Thu Jul 6 13:54:45 2023 -0600 Fix multiprocessing lambda pickling (#311) * Fix running plots in parallel The reason the plots were running slower before this change is because I was calling the plot function, not passing it to `submit`. So it was essentially running in serial, but worse because it was still spinning up/down the processes. * Fix multiprocessing lambda pickling (#20) * Refactor process_futures to be a dict This makes debugging much easier because you can associate the arguments to the future with the results. * Fix the pickling error when running in multiprocessing Only top-level functions (not lambdas) can be pickled to use in multiprocessing pools, thus the lambdas are converted to a regular function. * Further fixes to pickling multiprocessing error (#21) * Refactor process_futures to be a dict This makes debugging much easier because you can associate the arguments to the future with the results. * Fix the pickling error when running in multiprocessing Only top-level functions (not lambdas) can be pickled to use in multiprocessing pools, thus the lambdas are converted to a regular function. * Use Counter instead of defaultdict in CRISPRessoCORE * Update process_futures to dict in Batch and Aggregate commit ebb016dff46c280dce8c3c09e8ac0e0cc25d4d74 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Jul 3 17:12:09 2023 -0600 Enable CRISPRessoPooled multiprocessing when os allows multi-thread file append commit 7285da0e987b77b72c8885bb35940e0f50c146bd Author: Kendell Clement <k.clement.dev@gmail.com> Date: Fri Jun 23 16:50:33 2023 -0600 Fix print bug for invalid fastq commit 9acdeac67441f9a1d55ac94b153bcb68fb89b92c Author: kclem <k.clement.dev@gmail.com> Date: Wed Jun 21 16:03:48 2023 -0600 Slugify before creating filename - replaces invalid characters in batch names with _ commit f97e29c67de4c80b8d6b9cf334f363be4b514ade Author: Cole Lyman <Cole@colelyman.com> Date: Wed Jun 21 14:43:43 2023 -0600 Add verbosity argument to CRISPRessoAggregate (#18) fixes #306 (#307) * Add verbosity argument to CRISPRessoAggregate (#18) * Allow for amplicon and guide seqs to be some variant of NA in batch (#19) This was discovered when attempting to infer amplicon sequences in batch mode on the web interface, NAs were supplied for the amplicon sequences to the sub CRISPResso commands. commit 32e1e9797da5c3033cdc588e92f06b8813961953 Author: Mark Clement <u0351481@notchpeak30.int.chpc.utah.edu> Date: Wed Jun 21 14:01:00 2023 -0600 Allow for interrogation of overlapping sgRNA sites commit 7248ba8c4deee125ad1ec12fdf1294a84d5f6f93 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Jun 12 12:16:47 2023 -0600 Check input fastq file format Asserts input format of fastq files - including if gzipped files are missing the gz suffix. commit 83c8ab8f462e7d8c1d04c08c1a398b874f517251 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Jun 5 13:41:55 2023 -0600 Fix CRISPRessoArgParser commit 14a2c8577f566e1b72d5f4e72cd6cd22079610be Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Jun 5 13:29:31 2023 -0600 Cosmetic updates for command-line use - version bump to 2.2.13 - If no args are provided, the command line version will print out an abbreviated help message - parameters can be excluded from CRISPRessoArgParser commit 1cd54bc1d03360c3d8121ba9e66b3589fe1cf252 Author: Cole Lyman <Cole@colelyman.com> Date: Thu May 11 14:31:47 2023 -0600 Fix multiprocessing error, don't start pool when only using single thread (#302) * Update README to have consistent use of `--base_editor_output` (#16) * Add files via upload * Only start process pools when using multiple processes This is mainly to solve the issue when running on AWS Lambda, but this should improve single core performance overall. --------- Co-authored-by: Kendell Clement <k.clement.dev@gmail.com> commit 92a705c939b370373a70cf6ae9f1616de33288b9 Author: Cole Lyman <Cole@colelyman.com> Date: Thu May 11 14:31:06 2023 -0600 Update `base_editor` parameters in README and add Plot Harness (#301) * Update README to have consistent use of `--base_editor_output` (#16) * Add files via upload --------- Co-authored-by: Kendell Clement <k.clement.dev@gmail.com> commit 7d46c4490235df45c5546b1b470e4e6a99727031 Author: Cole Lyman <Cole@colelyman.com> Date: Wed May 10 15:41:33 2023 -0600 Clarify CRISPRessoWGS intended use (#303) * Update README to have consistent use of `--base_editor_output` (#16) * Add sample plotting jupyter notebook * Add clarifying info to CRISPRessoWGS description Clarify WGS usage commit 833a701787bb47674b3e921c38cac6189c775cf7 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu May 4 17:02:46 2023 -0400 Remove debug print statements commit 712eb2a11825e8d36f2870deb12b35486bd633fb Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu May 4 16:40:07 2023 -0400 Allow dashes in filenames resolve #73 commit a439f094745b2b5e7f032f0777d4c67e6d6f93c5 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sat Apr 22 23:41:58 2023 -0400 Raise exceptions from within futures in plot_pool commit 7e807a60de2a9d18bccd034b87106ceaf7153338 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sat Apr 22 23:38:56 2023 -0400 Fix future pandas indexing warning Pandas error was "FutureWarning: Calling float on a single element Series is deprecated and will raise a TypeError in the future. Use float(ser.iloc[0]) instead" commit 304a92aa7a7ef8c705cb070dce25d9a2e5745ba9 Author: Cole Lyman <Cole@colelyman.com> Date: Thu Apr 20 13:59:27 2023 -0600 Remove debug print statements fixes #295 (#297) The format string option used here is only available in Python version >=3.8. commit 478c06f784603e96d20f96e91993fdcc4ac35c8a Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Apr 13 12:09:26 2023 -0400 Update plotCustomAllelePlot.py script for #292 (#293) Update type of 'max_rows' param to int Fix location of 'args' in crispresso2_info object commit bcdae39e05d530f4a4e78738c3b30f7664981919 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Mar 27 13:18:34 2023 -0400 Update pooled parameter format commit 546446e36e7e68b527767d6c31ec341a49df2059 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Feb 14 16:26:23 2023 -0500 Fix running plots in parallel (#286) The reason the plots were running slower before this change is because I was calling the plot function, not passing it to `submit`. So it was essentially running in serial, but worse because it was still spinning up/down the processes. Co-authored-by: Cole Lyman <cole@colelyman.com> commit d75f32a2eb5aeaaee866c09e5655a3e27af8b1a1 Author: kclem <k.clement.dev@gmail.com> Date: Fri Feb 10 15:45:15 2023 -0500 Fix #283 to avoid filename collisions Previously, amplicon names longer than 21bp were truncated, but the check for uniqueness wasn't working, so it would overwrite some plot files. This fixes the filename collision and enforces uniqueness in reference filename prefixes. Thanks @mbiokyle29 commit e577318006cd17b2725bd028e5e56634c6eb829a Author: kclem <k.clement.dev@gmail.com> Date: Mon Feb 6 16:37:25 2023 -0500 Case-insensitive headers accepted in CRISPRessoPooled commit d34927620a4a6126a9988b3041e76f60728abbfe Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Jan 31 13:48:33 2023 -0500 Fix print statement in CORE commit ee88b7ed89c395f68225a50dea44a2ad69d5e9a5 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Jan 31 13:22:51 2023 -0500 Version bump to 2.2.12 commit 1d4679c72d0c8b4154317c9aff5179217198e2d7 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Jan 31 13:01:31 2023 -0500 Status Updates + Pooled Mixed Mode Update (#279) * Implement logging handler to overwrite the latest log status to file * Add StatusHandler to CRISPRessoCORE log This will take the latest log output and write it to a file (`status.txt`), the catch being that with each log the file is overwritten so that one can easily tell where CRISPResso currently is and what the error is (if any). These changes include some slight refactoring in order to accomodate any potential parameter exceptions. * Add StatusHandler to CRISPRessoBatch and refactor `logger.warn` to `warn` * Add StatusHandler to CRISPRessoPooled and a little refactoring * Implement `percent_complete` to the status log * Add StatusHandler to CRISPRessoAggregate log * Add StatusHandler to CRISPRessoCompare log * Add StatusHandler to CRISPRessoPooledWGSCompare log * Add StatusHandler to CRISPRessoWGS log * Rename `status.txt` to `CRISPResso_status.txt` * Modify status log names to match the tool they are generated from * Add percent_complete stages to CRISPRessoCORE These also include log statements of each plot that is being generated as well as fixing some variable name collisions with `ind`. * Format the percentage in the log to be 2 decimal places * Change all plotting logs from `info` to `debug` and simplify progress This refactors how the progress of the plots is calculated, making it much simplier. Before this change we would of had to keep track of the number of times `percent_complete` was output, but now it simply updates the percent complete after each amplicon is finished processing. Hopefully this will make things easier to mantain even though it will be a little less "accurate" (not sure how accurate the original implementation was...). * Implemented shared console log handler across all CRISPResso* calls This allows for easy changes to logging formatting, which was inspired by having to change the default logging level. The default logging level needs to be set at `logging.DEBUG` in order for the debug log statements to not be ignored for the running and status logs. * Add ability to set the verbosity level to each CRISPResso* tool This allows users to set a verbosity level between 1 and 4 using the `-v`/`--verbosity` CLI parameter. If the `--debug` flag is present, then the level will default to 4, being the most verbose. * Implement showing the last seen `percent_compelte` when none is provided * Keep track of and log when multiple parallel runs are completed These changes modify `CRISPRessoMultiProcessing.run_crispresso_cmds` such that we can now display when a run is completed. This potentially breaks how signals and interupts are handled with multiple runs happening, but this needs to be reviewed. * Add debug and percentage complete to CRISPRessoBatch * Add percent complete to CRISPRessoPooled * Add debug and percent_complete message to CRISPRessoAggregate * Add `percent_complete` to CRISPRessoCompare * Add `percent_complete` to CRISPRessoPooledWGSCompare * Add status and `percent_complete` to CRISPRessoMeta * Add `verbosity` arguments to CRISPRessoCompare and CRISPRessoPooledWGSCompare * Fixing documentation to match pooled headers * Header removal bug fix change documentation to guide_seq * Update documentation and help feature for CRISPRessoPooled * Remove extra newlines from CRISPRessoPooled -h * Make variable names as clear as my firstborn child's name * Update one more variable name * Fix bug to flow CRISPRessoPooled options to sub command * Make amplicon file args variable name clear * Update how parameters are set and retrieved from parameter object The refactor in the previous commit changed the type of the arguments to a dictionary which doesn't have the parameters as attributes, and this commit fixes that error. * Add note in output header for change in default CRISPRessoPooled In the next release (2.3.0) the `--demultiplex_only_at_amplicons` will be the default when running in mixed-mode. This is to allow for inexact alignments of the reads and the amplicons to the genome. For more context, see this issue https://github.com/pinellolab/CRISPResso2/issues/276 * Clarify the verbosity parameter help message * Separate out parameters to `normalize_name` in CRISPRessoCORE * Separate out parameters to `normalize_name` in CRISPRessoWGS * Separate out parameters to `normalize_name` in CRISPRessoPooled * Separate out parameters to `normalize_name` in CRISPRessoCompare * Fix bug in CRISPRessoPooled by replacing `database_id` with `normalize_name` * Refactor `run_crispresso_cmds` to not require a `logger` This commit implements the functionality to make the `logger` object optional by seeing which module called the `run_crispresso_cmds` function and obtaining the correct object from that module name. The function also immediately returns when no commands are passed to it. * Add amplicon name to plotting debug statements in CRISPRessoCORE --------- Co-authored-by: Cole Lyman <cole@coles-mbp-2.lan> Co-authored-by: Cole Lyman <cole@Coles-MacBook-Pro-2.local> Co-authored-by: Cole Lyman <cole@colelyman.com> Co-authored-by: Samuel Nichols <Snic9004@gmail.com> commit ff7eca76e6a3a08af4ac18ac4e88d20f2a06b1f9 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jan 26 15:27:27 2023 -0500 CRISPRessoPooled custom header fix (#278) * Fixing documentation to match pooled headers * Header removal bug fix change documentation to guide_seq * Update documentation and help feature for CRISPRessoPooled * Remove extra newlines from CRISPRessoPooled -h * Make variable names as clear as my firstborn child's name * Update one more variable name Co-authored-by: Samuel Nichols <Snic9004@gmail.com> commit 104866e1080c973bb025d1a5ba59b19dca1658af Author: Cole Lyman <Cole@colelyman.com> Date: Thu Jan 5 14:00:26 2023 -0700 Fix deprecated numpy type names (fixes #269) (#270) In the most recent version of numpy (1.24) some of the types have been deprecated. This commit fixes these errors. commit 58a8e42df88b66fad6b4f6ad04a5b9d9d43d01b4 Author: Cole Lyman <Cole@colelyman.com> Date: Thu Jan 5 06:49:35 2023 -0700 Add snippet about installing CRISPResso2 via bioconda on Apple silicon (#274) I have suffered enough trying to debug my installation, so hopefully this helps someone else. Co-authored-by: Cole Lyman <cole@coles-mbp-2.lan> commit b9851e98104602eb78c2b384105267624295e9d3 Author: Cole Lyman <Cole@colelyman.com> Date: Thu Dec 22 13:30:23 2022 -0700 Fix bug when pooled bam is input (#265) This change checks to see if a bam file was input, and if so it doesn't try to remove any intermediate files because there aren't any. Co-authored-by: Cole Lyman <cole@coles-mbp-2.lan> commit b822612642043e75a19042941f69b457ce51f517 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Dec 19 15:26:45 2022 -0500 Delete vscode settings commit b99aa624dec68ef7d19264340ce0cafa829625f4 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Dec 19 13:29:14 2022 -0500 Clarify input param help for pooled bam commit 3fae1e8b821ec6b1890bff6561fa8fa67dc49a04 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Dec 19 13:28:54 2022 -0500 Fix #235 - Cigar string is * if read unaligned Previously, the bam would set the cigar string to 0 if the read was unaligned. This breaks the sam->bam conversion and causes the errors in #235. commit c65ba07dc5a983453cdf7bb1e27005230dac6f1b Author: Cole Lyman <Cole@colelyman.com> Date: Thu Dec 8 13:48:17 2022 -0700 Add deprecation notice (#260) * Add FLASh and Trimmomatic deprecation notice to CLI output * Add Edilytics email address to CLI output commit 2a30e5a45f5350ee7c6435bce1cd4edc4d31668a Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Dec 6 12:16:19 2022 -0500 Format filterReadsOnSequencePresence script commit 9d764414edd88a46ad5e4f496e4f1c8d5d60ce3e Author: Kendell Clement <k.clement.dev@gmail.com> Date: Fri Dec 2 22:12:54 2022 -0500 Clarify default CRISPRessoPooled settings for use_legacy_bowtie2_options_string commit 9ddea40f7f02b546941ddaa4c71fc5283075051a Author: kclem <k.clement.dev@gmail.com> Date: Mon Nov 14 10:33:04 2022 -0500 Add check for prime editing extension sequence in prime edited sequence if the user specifies the prime_editing_override_prime_edited_ref_seq, it could not contain the extension seq (if they don't provide the extension seq in the appropriate orientation), so check that here. Extension sequence should be provided reverse-complement to the prime edited sequence. commit 152f2dd5001da7090641ee8a1326bde9f7e8104e Author: kclem <k.clement.dev@gmail.com> Date: Wed Nov 9 11:53:41 2022 -0500 Version bump to 2.2.11a commit 9ed356e3a0c6c316d0860d121772f80ddca6de1d Author: kclem <k.clement.dev@gmail.com> Date: Wed Nov 9 11:47:30 2022 -0500 Add param to override prime editing sequence checks CRISPResso checks that prime editing guides are provided in the proper orientation (e.g. pegRNA 3'->5', spacer sequence 5'->3') and checks these orientations by alignment. Sometimes, the alignment can be better in the opposite direction, and this parameter allows these checks to be overridden. Otherwise, these checks would halt the program and produce the output 'The prime editing pegRNA spacer sequence appears to be given in the 3\'->5\' order. The prime editing pegRNA spacer sequence (--prime_editing_pegRNA_spacer_seq) must be given in the RNA 5\'->3\' order.' commit 39dd80afb98a22b7edb6f801c363d86bb77eeb5b Author: kclem <k.clement.dev@gmail.com> Date: Wed Nov 9 10:06:51 2022 -0500 Update filterReadsOnSequencePresence.py commit fe55526927e3fb6e17c9a8a6f59c7057bc1e14eb Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Nov 7 22:25:16 2022 -0500 Add script to filter input based on sequence presence commit 713e57a19c35180035ca35e11a5820065eda0198 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Oct 18 16:02:26 2022 -0400 Allow spaces in read names for CRISPRessoWGS commit 39ce008bdddccdd8229c0ba185dce78bc2f66968 Author: Cole Lyman <Cole@colelyman.com> Date: Sat Oct 8 21:09:58 2022 -0600 Fix typo of CRISPResssoPlot when plotting nucleotide quilt (#250) commit 6a2b342c8503b7327c0a2414edfbd16912d60ca5 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sat Oct 8 23:08:47 2022 -0400 Batch amplicon plots (#251) * Error out if HDR amplicon matches existing amplicon * Add check for amplicon sequence uniqueness * Fix bug with bam_input not having bam_output * Test for no returned lines in auto mode, version bump to 2.2.11 * Fix pandas deprecation of df.append commit 726b2b93d6e419a1b0aa6a968c97edc55b4cc5a8 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Oct 6 16:32:02 2022 -0400 Fix CRISPRessoBatch plot pool bug when plots are suppressed commit 7e5049c4dfb88cbc87c91935a91d1f51120a10c2 Author: Cole Lyman <Cole@colelyman.com> Date: Wed Sep 21 21:04:51 2022 -0600 Fix batch quilt plot name (#249) This fixes an incorrectly named allele quilt plot input in CRISPRessoBatch. commit 1821ca5029c5a1485733f13ab3f2048b4f1fa04e Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Sep 15 15:49:08 2022 -0400 Version bump to 2.2.10 commit c5f79aebfc1ae209f4ee320df250eed89a02787c Author: Cole Lyman <Cole@colelyman.com> Date: Wed Sep 14 14:24:55 2022 -0600 Parallel plot refactor (#247) * Fix duplicate plotting in CRISPRessoBatch aggregate * Refactor mulltiprocessing plots in CRISPRessoBatch * Refactor multiprocessing plots in CRISPRessoCORE * Refactor multiprocessing plots for CRISPRessoAggregate commit 4ed5e24e6cc1dd8068e2391573ae2438acd32db2 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Sep 13 14:12:11 2022 -0400 print files in curr dir if Aggregate can't find files commit ce25bc06f29988e7a10afd0b6a09ba0caf0950e0 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Sep 12 10:32:57 2022 -0400 Spelling typo commit c15f01c75083403f17c58c121b2afe97e9f2a1ec Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Sep 6 17:49:52 2022 -0400 Add helper function to create alignment scoring matrix New scoring matrix can be created using CRISPResso2Align.make_matrix() commit c80f82838c5a228b79ad4484092877cfee08e02c Author: Cole Lyman <Cole@colelyman.com> Date: Mon Aug 22 18:28:33 2022 -0600 Add `zip_output` (#240) * Making zip of results * Zip command added, if zip is true place_report_in_output_folder is also true, zip removes all files while zipping * Adding --zip to compare and pooled/wgs compare * Add more formatting changes to CRISPRessoShared * Refactoring propagate_crispress_options so only one version exists * Zip added to arguments_to_ignore and warning added when changing arguments * Restore styling * Update README to include --zip * Rename --zip to --zip_output * Change --zip to --zip_output in CompareCORE and PooledWGSCompareCORE * Bug fix arg to args Co-authored-by: Samuel Nichols <Snic9004@gmail.com> commit 5de3d7286d8e33c7cf4d3615fce715806e72f511 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Aug 11 21:42:34 2022 -0400 Fix fix to aggregate for CRISPRessoWGS commit a2294c266f43b14969a5d6474076f31a77a57173 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Aug 11 21:40:50 2022 -0400 Fix bug in aggregate for WGS commit 7ce3eb4abe4b8ceac933272ac9cb16a8bedf26a3 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Aug 8 21:53:45 2022 -0400 Update CRISPRessoWGS to allow non-word characters in region names commit 040ac0033d6e250f4e3a412101874cf5e914e08a Author: kclem <k.clement.dev@gmail.com> Date: Mon Aug 8 16:04:59 2022 -0400 Enable processing of cram files by CRISPRessoWGS Adds --reference to samtools view when viewing cram files commit cf112a0caba8789e28530cc09171285ec6ea9b4c Author: kclem <k.clement.dev@gmail.com> Date: Mon Aug 8 14:55:46 2022 -0400 Auto amplicon detection for interleaved input Enables processing of interleaved fastq files for guess_guides and guess_amplicons, as well as get_most_frequent_reads. When interleaved input is present, the input is first separated into R1/R2 files, then processing is performed. commit 4ba524dc7b947feca8a0f743837844f9febc2171 Author: Cole Lyman <Cole@colelyman.com> Date: Thu Aug 4 11:32:11 2022 -0600 Potential fix for aggregate plots in Batch mode (#237) commit 6097a8a104d3f156ef7c08e196ac37e32bf04c71 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jul 21 22:45:48 2022 -0400 Fix pct_vectors in crispresso2_info json object commit 65a079d86d6f386793397398f839c46014b54543 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed Jul 20 23:46:37 2022 -0400 Fix more readme spelling bugs commit e817376ecd54cdea1f29e303ca25b9e7d1d38333 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed Jul 20 23:42:23 2022 -0400 Fix bug in readme spelling commit 49740ba1d66ed6d13a9e154b8b17bc8b5186581d Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed Jul 20 16:10:09 2022 -0400 Fix loading of crispresso info from WGS and Pooled commit b68a43271115251b18e8955e285ccc18f549e8cd Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jul 14 14:11:04 2022 -0400 Add plotly to dockerfile commit b0b7d41d697304d0d5fc93e3346c9de1b98ba41d Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jul 14 14:10:00 2022 -0400 Fix #231 Allow N's in bam output (Try 2) commit c460b3e73fd06a230dbac2e37c86b833144ebf94 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jul 14 14:09:10 2022 -0400 Revert "Fix #231 Allow N's in bam output" This reverts commit 2f6ad1dbe05210af9ccc1b1f17783cd212a888d3. commit 2f6ad1dbe05210af9ccc1b1f17783cd212a888d3 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jul 14 13:52:37 2022 -0400 Fix #231 Allow N's in bam output commit 0a2419e518dc9b3520058c3927f98b31cd51347e Author: Cole Lyman <Cole@colelyman.com> Date: Fri Jul 8 21:10:01 2022 -0600 Fix bug when name is provided instead of amplicon_name in pooled input file (#229) Also, raise an exception (instead of incorrectly executing) when there are not enough matched parameters in the pooled input file. commit cb58212379803788c04ca5793baaa760cbbeaa81 Author: Cole Lyman <Cole@colelyman.com> Date: Fri Jul 8 21:09:49 2022 -0600 Fix bug when comparing two samples with the same name. (#228) commit e8a796f5f451409cbafed4404dfba4b6b8a124ca Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jun 23 21:30:23 2022 -0400 Version bump to 2.2.9 commit 632143ddedea48bab9229baeb4bf3ea4d1f658d6 Author: Cole Lyman <Cole@colelyman.com> Date: Mon Jun 20 19:53:14 2022 -0600 Don't run global frameshift plot when there are no reads (#226) When there are no reads (i.e. global_MODIFIED_FRAMESHIFT + global_MODIFIED_NON_FRAMESHIFT + global_NON_MODIFIED_NON_FRAMESHIFT == 0) there was a bug when trying to compute the pie chart, because all of the values in the pie chart are 0. This fix, will make sure that there is at least one read in order for the plot to bee constructed properly. commit 4bb06218e835d2624d53fd401542caef6f8a3a55 Author: kclem <k.clement.dev@gmail.com> Date: Fri Jun 3 16:57:02 2022 -0400 Improvements for guide inference in 'auto' mode In 'auto' mode, a putative guide sequence is selected at the site of maximal editing. If the site of maximal editing happens near the end of the guide (e.g. base 0) many things will break (e.g. quantification windows, etc). This update excludes bases from being used to find the guide using the --exclude_bp_from_left and --exclude_bp_from_right parameters. At default, these parameters are 15bp, so the first and last 15bp would not be selected for the site of maximal editing and thus be the site of a guide sequence. In addition, the site of maximal editing must have 3x the magnitude over the background. commit 9d64de187835b2553ad2b4374d32edab27f83645 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jun 2 20:22:25 2022 -0400 Update README.md commit 6aafc5387986f5089ba55b68d128343d68052792 Author: Simon P Shen <sshen8@users.noreply.github.com> Date: Tue May 31 17:42:53 2022 -0400 directory in quotes in batch cmd (#222) Add quotes around output folder for folders that have spaces. commit 432f163ac68b9a650d1fd326171aadc505ee87f4 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue May 24 23:38:36 2022 -0400 CRISPRessoBatch fills NA values in batch settings NA values in CRISPRessoBatch are filled with the value from args - either the default value or the value from the command line args (if set) commit 6de774adbad3aa8cd99d07b0ba7692984b356cd4 Author: kclem <k.clement.dev@gmail.com> Date: Mon May 23 14:18:02 2022 -0400 Fix file naming bug for HDR outputs In html file, figures 4e and 4f incorrectly referenced figure 4d. This fixes this bug. commit b88fec0668a4082a12ead3d26582e86d829dd7cc Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sat May 21 00:32:15 2022 -0400 For bam_output, fix bug that wrote unaligned lines twice commit 3564e77ebcdedb4b01cc01dcca18ba3221fac67c Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu May 19 16:32:18 2022 -0400 Update README with CRISPRessoPooled headers and bam_output parameters commit bc08d81f17cb1929d1c37a1773cffcf36fb12fe2 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu May 19 16:11:30 2022 -0400 Add more links to tools commit 006c497a379ecd94b017a883a5db887861e1586a Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu May 19 16:08:14 2022 -0400 Add links to tools commit dc8243373ad00d6bd467fc30c59942596ff0c5d6 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon May 16 21:38:06 2022 -0400 fastq_to_bam implementation (#219) commit e88b6833977c6b2768299e0b2e7af623e3a9ae7c Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sun May 8 02:14:13 2022 -0400 Fix bug for when guides don't agree in CRISPRessoAggregate commit 7eb763116a8c60603f1cd654645215767ee8eb52 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu May 5 03:28:21 2022 -0400 Fix bug for case of empty summary plots in report generation commit 0324fa67d14ed945f0c9531d9bcf73ebcf4ca042 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu May 5 03:28:02 2022 -0400 Create report for number of significant bases in CRISPRessoCompare commit e3c9d0026a9ee6732f3ed6bdcf2a824850d7e66a Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 22:43:11 2022 -0400 Update pickle to json in readme and CRISPRessoPooledWGSCompare commit 1553f7977c12bf1091a20ca55b878bccfb739b61 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 18:10:04 2022 -0400 Merge pull request #4 from pinellolab/master (#218) commit bcecbfc047d294e26f381a6668e08cb4db24445c Merge: 15b0e05b bb13e007 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 18:06:37 2022 -0400 Merge branch 'master' into master commit bb13e007738d6e7a4909e01f03daff592f334f36 Merge: af4ab6e8 d0b41483 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 17:59:32 2022 -0400 Merge branch 'master' of https://github.com/edilytics/CRISPResso2 commit 15b0e05b9e03bbec5236e58776ddf9aa2f93180e Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 17:54:52 2022 -0400 2 flexible pooled input (#217) * Batch type coerce and r2 file check * Upgrade tabs for bootstrap5 * Update readme with additional pooled amplicon file headers Co-authored-by: Samuel Nichols <Snic9004@gmail.com> commit d0b41483bee704940ba60c58289f412b04c71659 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 13:43:43 2022 -0400 Update README.md commit ce49fab5301cb73ba0daf6c765e350eb083c76f1 Merge: 5f909713 b913fcb4 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 13:40:30 2022 -0400 Merge pull request #3 from edilytics/2-flexible-pooled-input Add flexibility to CRISPRessoPooled amplicon input by allowing headers. Also, prime editing and quantification window coordinate parameters can be passed to CRISPRessoPooled. commit b913fcb402a8ba3106c3ff7913563a33d8d19fca Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 13:38:25 2022 -0400 Update CRISPRessoPooledCORE.py Replace process to read header, increase flexibility for column order commit 945bf31f16530b7ce25b89095b2c7005bf146117 Merge: 7b8f6788 5f909713 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 12:45:24 2022 -0400 Merge branch 'master' into 2-flexible-pooled-input commit 5f9097133765736a7c2fe3c8e9b730845fed0b70 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 12:23:44 2022 -0400 Version bump to 2.2.8 commit c4a94ce0e06c6ebae13e128fbe6b708e635121c4 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 00:13:17 2022 -0400 Fix summary plot representation for multi reports *fixed old reference to make_multi_report which called old summary plot format * renamed summary_plot to summary_plots to reflect a dict with multiple plots commit 62900e9ae6fa37ce99a04f12a63ed5c912f75042 Author: Cole Lyman <Cole@colelyman.com> Date: Tue May 3 20:47:52 2022 -0600 Large aggregation (#192) * Squashed commit of the following: commit 8564eb03f0d9e62abf4b7528baf5c2ae296be8f9 Merge: f6ef62c 07cc7d8 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Jan 11 16:20:15 2022 -0500 Merge branch 'indel-alignment-fix' of https://github.com/edilytics/CRISPResso2 into indel-alignment-fix commit 07cc7d856ab3fcbbaa5381f17f29568192388887 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:29:59 2021 -0700 Fix bug in `find_indels_substitutions` This bug occurred when there was a deletion at the end of a sequence, and was thus not properly accounted for. commit f6ef62cfdf909adac1b10ea86555cd218f8b2a74 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:29:59 2021 -0700 Fix bug in `find_indels_substitutions` This bug occurred when there was a deletion at the end of a sequence, and was thus not properly accounted for. commit 7212f87f4be60057a6c848947ff6b5efde132a25 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:26:17 2021 -0700 Add a unit test for `find_indels_substitutions` This unit test checks for deletions at the end of a sequence, which are inherently outside of the include_indx_set window. commit d50b4e903b973c71a275e31d470b40e59280ee13 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:03:22 2021 -0700 Fix a bug in `find_indels_substitutions` The bug that this commit fixes is when an insertion occurs at the edge of the include indexes. The trouble with this earlier was that it was using the `idx` to calculate the size of the insertion, but the `idx` wasn't being incremented anymore because it was outside of the include window. commit 4db066f7bc333b7662a9232ac732ebb33ac3ace8 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:01:39 2021 -0700 Add test case for `find_indels_substitutions` This test case is extracted from the CRISPRessoBatch integration test and provides an example where there is an insertion at the edge of the include index. commit 3b3a7417f5bbd6c2785a2af54a47e01d2e820451 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 11:37:07 2021 -0700 Fix bug in CRISPRessoCompare where sample names were not properly set This was a place where it was (partially) missed during the crispresso2_info object refactoring. commit e9f5eff3d95b676b5ee2e23371a5604f600d34b2 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:26:17 2021 -0700 Add a unit test for `find_indels_substitutions` This unit test checks for deletions at the end of a sequence, which are inherently outside of the include_indx_set window. commit d4d45a918254ab19a7e7956e9e731389c6f36ecb Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:03:22 2021 -0700 Fix a bug in `find_indels_substitutions` The bug that this commit fixes is when an insertion occurs at the edge of the include indexes. The trouble with this earlier was that it was using the `idx` to calculate the size of the insertion, but the `idx` wasn't being incremented anymore because it was outside of the include window. commit 13f00bb40239c83e6e5cf844561fdb7000d3d9ab Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:01:39 2021 -0700 Add test case for `find_indels_substitutions` This test case is extracted from the CRISPRessoBatch integration test and provides an example where there is an insertion at the edge of the include index. commit 659ae34e8fd106f7ecc163b5bea0b5a80ab0283c Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 11:37:07 2021 -0700 Fix bug in CRISPRessoCompare where sample names were not properly set This was a place where it was (partially) missed during the crispresso2_info object refactoring. * Add parameter `--suppress_batch_summary_plots` If many runs are run at the same time, batch summary plots may fail because they are too large for matplotlib. This parameter `--suppress_batch_summary_plots` allows individual runs to be plotted, but suppresses batch summary plots that may otherwise be too big. * Pep formatting cleanup * Add summary nucleotide plots to aggregate * Aggregate plots are paginated * Update CRISPRessoAggregateCORE.py Remove max sample limit for plotting * Add --max_samples_per_summary_plot to CRISPRessoAggregate Parameterize the max number of samples to plot on each page of reports. Additional PDFs will be created with this number of samples on them. * Add plotly function to plot an interactive heatmap * Fix deprecated numpy type to suppress warning * Add plotting of heatmaps to CRISPRessoAggregateCORE to summarize modification types These heatmaps are interactive (zoomable and panable) and show for each sample the percentage of insertions, substitutions, and deletions. * Add the heatmap summaries to the CRISPRessoAggregate report * Update Bootstrap to 5.1.3 This is mainly so that we can use the fullscreen modal functionality in this version. * Move the plotly heatmaps to a Bootstrap modal * Fix bug where plots were not filling up entire modal. I have tried countless different ways for this to work, and this is the best that I can come up with. After the modal is opened it triggers the plot to resize, and then for some reason you need to trigger the resize event. I think this is because a `div` changing size won't actually trigger the resizing of the plot (and neither will just calling `Plotly.Plots.resize`...?!). * Update the axis labels and add autosize to plotly heatmaps I'm pretty sure the autosize doesn't do anything, but it is there for good measure. * Abandon attempts to make plots fullscreen This includes removing the Bootstrap modal (two out of the three plots would resize properly and I couldn't figure out a way to have the plot displayed outside of the modal). I have left in some javascript to make the plot fullscreen, but I couldn't get the formatting quite right and the plot wasn't much bigger in the fullscreen version because there was a ton of space between the plot and the heatmap. If some brave soul would like to tackle it, feel free! * Rename and refactor how plot data is passed around I have consolidated how the plot data is passed around, so that now you can pass in only one dict with all of the information instead of 4 or 5 separate parameters. I also renamed the `heatmap_plot_*` to `allele_modification_heatmap_*`. * Implement the line plot version of the modification percentages This also includes correctly resizing the plot when the line plot tab is selected! * Change default `max_samples_per_summary_plot` to be 150 instead of 250 * Remove extra assignments of `this_number_samples` and suppress plot The plot that is suppressed is the large nucleotide quilt when there is a large number of samples. Is it okay to suppress this plot @kclem? * Implement parallel plotting in CRISPRessoAggregate * Fix sample indexing error and heatmap scaling for large number of samples * Add parameter `--suppress_batch_summary_plots` If many runs are run at the same time, batch summary plots may fail because they are too large for matplotlib. This parameter `--suppress_batch_summary_plots` allows individual runs to be plotted, but suppresses batch summary plots that may otherwise be too big. * Pep formatting cleanup * Add summary nucleotide plots to aggregate * Aggregate plots are paginated * Update CRISPRessoAggregateCORE.py Remove max sample limit for plotting * Add --max_samples_per_summary_plot to CRISPRessoAggregate Parameterize the max number of samples to plot on each page of reports. Additional PDFs will be created with this number of samples on them. * Add plotly function to plot an interactive heatmap * Fix deprecated numpy type to suppress warning * Add plotting of heatmaps to CRISPRessoAggregateCORE to summarize modification types These heatmaps are interactive (zoomable and panable) and show for each sample the percentage of insertions, substitutions, and deletions. * Add the heatmap summaries to the CRISPRessoAggregate report * Update Bootstrap to 5.1.3 This is mainly so that we can use the fullscreen modal functionality in this version. * Move the plotly heatmaps to a Bootstrap modal * Fix bug where plots were not filling up entire modal. I have tried countless different ways for this to work, and this is the best that I can come up with. After the modal is opened it triggers the plot to resize, and then for some reason you need to trigger the resize event. I think this is because a `div` changing size won't actually trigger the resizing of the plot (and neither will just calling `Plotly.Plots.resize`...?!). * Update the axis labels and add autosize to plotly heatmaps I'm pretty sure the autosize doesn't do anything, but it is there for good measure. * Abandon attempts to make plots fullscreen This includes removing the Bootstrap modal (two out of the three plots would resize properly and I couldn't figure out a way to have the plot displayed outside of the modal). I have left in some javascript to make the plot fullscreen, but I couldn't get the formatting quite right and the plot wasn't much bigger in the fullscreen version because there was a ton of space between the plot and the heatmap. If some brave soul would like to tackle it, feel free! * Rename and refactor how plot data is passed around I have consolidated how the plot data is passed around, so that now you can pass in only one dict with all of the information instead of 4 or 5 separate parameters. I also renamed the `heatmap_plot_*` to `allele_modification_heatmap_*`. * Implement the line plot version of the modification percentages This also includes correctly resizing the plot when the line plot tab is selected! * Change default `max_samples_per_summary_plot` to be 150 instead of 250 * Remove extra assignments of `this_number_samples` and suppress plot The plot that is suppressed is the large nucleotide quilt when there is a large number of samples. Is it okay to suppress this plot @kclem? * Implement parallel plotting in CRISPRessoAggregate * Fix sample indexing error and heatmap scaling for large number of samples * Add plotly requrement to setup.py * Remove space around vertical barcharts * Add scrollbar to long images in multiReport * Fill in default (empty) values to allele modification plots When not running CRISPRessoAggregate, default values for the `allele_modification_heatmap_plot` and `allele_modification_lin_plot` dictionaries will be set so that the template can be properly rendered. * Include CRISPRessoBatch in the refactor of how summary_plot dicts are handled * Update dockerfile for new docker * minor bug fixes for plotCustomAllelePlot.py to work with Python3 (#212) * Allow for flexible parsing of quant window coordinates * CRISPRessoPooled debug flash command, fix pep formatting * Set flexiguide homology parameter type to int * Coerce ints in batch file checking (#200) * Batch type coerce and r2 file check * Revert "Batch type coerce and r2 file check" This reverts commit f91736688ea9739cf3063e3601c52ad6da1116a4. * Coerce int values * Handle multiple qwcs in batch mode If multiple qwcs were provided in batch mode, a parsing error would occur. This fixes this bug. * Fix bug from old pandas for int cols Evidently old pandas versions throw an error if a column doesn't exist. This checks to see if the column exists before the values are set. * Create allele modification heatmaps and line plots in CRISPRessoBatch * Add allele modification heatmaps and line plots to CRISPRessoBatch * Make all plots in CRISPRessoBatch run in parallel * Make `--suppress_batch_summary_plots` store true Also, only open and shutdown the process pool when necessary. * Add blank values for allele_modification entries when not present Co-authored-by: Kendell Clement <k.clement.dev@gmail.com> Co-authored-by: dharjanto <dewi.harjanto@gmail.com> Co-authored-by: Samuel Nichols <Snic9004@gmail.com> commit f67376fc9ab0e407d4086aa42fd1c77706ebc9c0 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Fri Apr 15 00:46:30 2022 -0400 Fix bug from old pandas for int cols Evidently old pandas versions throw an error if a column doesn't exist. This checks to see if the column exists before the values are set. commit b34fe2956ff88629809b2434878028723dfc4895 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Apr 14 23:58:07 2022 -0400 Handle multiple qwcs in batch mode If multiple qwcs were provided in batch mode, a parsing error would occur. This fixes this bug. commit c94e3b9f2e301bda91e9c1e6f4ef794b33b5dbf0 Author: Samuel Nichols <Snic9004@gmail.com> Date: Thu Apr 14 21:48:32 2022 -0600 Coerce ints in batch file checking (#200) * Batch type coerce and r2 file check * Revert "Batch type coerce and r2 file check" This reverts commit f91736688ea9739cf3063e3601c52ad6da1116a4. * Coerce int values commit fc4542491bb86eb143db0044a848a56234403496 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Apr 14 22:13:23 2022 -0400 Set flexiguide homology parameter type to int commit 23fe2aa8e26067d1bcf36bfafc67e023c7588d2f Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Apr 14 22:12:37 2022 -0400 CRISPRessoPooled debug flash command, fix pep formatting commit d292d33d8c1fa3bfd2cee656643fd47bcdab161d Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Apr 14 22:00:19 2022 -0400 Allow for flexible parsing of quant window coordinates commit e1667cb53a7ea6fbb33369c8530a78639ed423ec Author: dharjanto <dewi.harjanto@gmail.com> Date: Mon Apr 11 22:08:21 2022 -0400 minor bug fixes for plotCustomAllelePlot.py to work with Python3 (#212) commit 7b8f6788da18f6ab173fa3c3d10f4ab6bb2acc26 Author: Samuel Nichols <Snic9004@gmail.com> Date: Fri Apr 8 10:21:00 2022 -0600 Update README commit 9bc24cd0474ed9f398dff64274d3181c4b2f8637 Author: Samuel Nichols <Snic9004@gmail.com> Date: Tue Mar 29 11:25:09 2022 -0600 Using Amplicon_Name commit 88ac5d72074b3da63de035e02c911ce34cd29414 Merge: b6057a2d e5afa478 Author: Samuel Nichols <Snic9004@gmail.com> Date: Mon Mar 28 22:32:09 2022 -0600 Merge remote-tracking branch 'origin/master' into 2-flexible-pooled-input commit b6057a2d54cb8637ff0900416de8e2de72213f76 Author: Samuel Nichols <Snic9004@gmail.com> Date: Mon Mar 28 20:53:05 2022 -0600 Printing info statements for matched headers commit af4ab6e8507d7aa4b7b68f217a458e0d9c966f55 Merge: bbb7d6f0 51a943c3 Author: Cole Lyman <Cole@colelyman.com> Date: Fri Mar 25 09:44:13 2022 -0600 Merge branch 'pinellolab:master' into master commit 3c1eb012fc02563e3e963f17a62c7e932f5bcddc Author: Samuel Nichols <Snic9004@gmail.com> Date: Thu Mar 24 12:31:43 2022 -0600 Debugging and column checking commit 0b47acbc592a6df6adf14641357b2104b76be691 Author: Samuel Nichols <Snic9004@gmail.com> Date: Wed Mar 23 09:42:51 2022 -0600 New variables added to pooled commit a0ff3a44d6d19d7b37f91919b5c0180206f72d53 Author: Samuel Nichols <Snic9004@gmail.com> Date: Mon Mar 21 09:32:28 2022 -0600 Read as string not bytes commit 710675fc3c0307e21103abd604315b47ff80a894 Author: Samuel Nichols <Snic9004@gmail.com> Date: Wed Mar 16 13:51:30 2022 -0600 Adding command building for new options commit f386818a48e5c840bd567611e6f1320c8146cac7 Author: Samuel Nichols <Snic9004@gmail.com> Date: Wed Mar 16 10:08:33 2022 -0600 Comment out df_template.iloc instance commit eb5e309da57c8b96cd760728ddbf67be05f30d1c Author: Samuel Nichols <Snic9004@gmail.com> Date: Wed Mar 16 09:59:19 2022 -0600 Potential solution for flexible headers commit 51a943c3a8f8181963acc420e75a5e8ee103cf7c Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Mar 15 11:00:46 2022 -0400 CRISPRessoPooled pep formatting and fix CRISPRessoPooled doesn't re-count reads if it has been run once and the `aligned_pooled_bam` is provided as input pep code formatting changes commit bbb7d6f0907aa13518d20e7f470e7de518b825f4 Merge: ddbd39f0 5a10d638 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Mar 15 10:23:38 2022 -0400 Merge branch 'master' of https://github.com/edilytics/CRISPResso2 commit 5a10d638c638f21f8a2934955e92ef7e117b889e Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sat Feb 26 14:21:57 2022 -0500 Move metadata for bam input and output commit e5afa4784d5330a1dc95c5deafcd9217edeac631 Author: Samuel Nichols <Snic9004@gmail.com> Date: Wed Feb 16 10:20:24 2022 -0700 Coerce int values commit ede7d85b50055311908000578c76a1860ae9de4d Author: Samuel Nichols <Snic9004@gmail.com> Date: Wed Feb 16 10:18:29 2022 -0700 Revert "Batch type coerce and r2 file check" This reverts commit f91736688ea9739cf3063e3601c52ad6da1116a4. commit f91736688ea9739cf3063e3601c52ad6da1116a4 Author: Samuel Nichols <Snic9004@gmail.com> Date: Wed Feb 16 10:10:52 2022 -0700 Batch type coerce and r2 file check commit 7b4a310b0f8b64c00e02eca3d522ad50d39b43ae Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Feb 15 22:18:05 2022 -0500 Reiterate WGS region file is tab-separated Add note to WGS description that region file should be tab-separated. Closes #199 commit b8497542e388ad401d0815d426f27abc3201a76d Author: kclem <k.clement.dev@gmail.com> Date: Fri Feb 11 15:07:14 2022 -0500 Extend x-axis to longest scaffold incorporation length commit ab7248947afade089809c74bfe6e9d5394e8f6dc Author: kclem <k.clement.dev@gmail.com> Date: Wed Feb 9 17:05:11 2022 -0500 Fix prime editing indexing for plots commit ddbd39f06b262d5ebd2cc69e116c08b22b6bd84e Merge: a7ffd468 442a48c7 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jan 13 15:35:36 2022 -0500 Merge branch 'pinellolab:master' into master commit 442a48c7f4c62ec2ebc95fe268475e5e2a4b2f0c Author: Cole Lyman <Cole@colelyman.com> Date: Tue Jan 11 15:28:28 2022 -0700 Indel alignment fix (#182) * Fix bug in CRISPRessoCompare where sample names were not properly set This was a place where it was (partially) missed during the crispresso2_info object refactoring. * Add test case for `find_indels_substitutions` This test case is extracted from the CRISPRessoBatch integration test and provides an example where there is an insertion at the edge of the include index. * Fix a bug in `find_indels_substitutions` The bug that this commit fixes is when an insertion occurs at the edge of the include indexes. The trouble with this earlier was that it was using the `idx` to calculate the size of the insertion, but the `idx` wasn't being incremented anymore because it was outside of the include window. * Add a unit test for `find_indels_substitutions` This unit test checks for deletions at the end of a sequence, which are inherently outside of the include_indx_set window. * Fix bug in CRISPRessoCompare where sample names were not properly set This was a place where it was (partially) missed during the crispresso2_info object refactoring. * Add test case for `find_indels_substitutions` This test case is extracted from the CRISPRessoBatch integration test and provides an example where there is an insertion at the edge of the include index. * Fix a bug in `find_indels_substitutions` The bug that this commit fixes is when an insertion occurs at the edge of the include indexes. The trouble with this earlier was that it was using the `idx` to calculate the size of the insertion, but the `idx` wasn't being incremented anymore because it was outside of the include window. * Add a unit test for `find_indels…
Snicker7
added a commit
to edilytics/CRISPResso2
that referenced
this pull request
Apr 4, 2024
* imports C2Pro plots if available * added --use_matplotlib flag * added C2Pro matched api funciton signatures * added api args for plotly * added **kwargs * renamed config to custom_config, more specificity * added backend flag for plotly kaleido * added pro_installed boolean for templates, added plotly dependency to report templates * Squashed commit of the following: commit c909ea3b34e87ce637e00dac075d2bb2f8bfb954 Author: McKay <mbowcut@gmail.com> Date: Thu Feb 15 15:55:23 2024 -0700 added plotly dependency for pro commit 76b3601f6a0144f100266153f1c999e0c5de65de Author: Samuel Nichols <Snic9004@gmail.com> Date: Fri Jan 12 09:56:19 2024 -0700 Squashed commit of the following: commit 603f2eff9d1aa21ae95f3e134da303b8018d3a33 Author: Samuel Nichols <Snic9004@gmail.com> Date: Fri Jan 12 09:48:20 2024 -0700 fix guardrials partial commit 22fc03183a8070c30dfb74d5c23575ac19019855 Author: Samuel Nichols <Snic9004@gmail.com> Date: Fri Jan 12 08:54:01 2024 -0700 Add guardrail partial commit e55f6b21972b578261bc5a864ce1d653d98f9e34 Author: Samuel Nichols <Snic9004@gmail.com> Date: Mon Jan 8 07:50:59 2024 -0700 Functional guardrails, needs reports update commit 6e968e9699ed59a47d88191d03768e042d8b60a4 Merge: 32b49685 e948ce10 Author: Samuel Nichols <Snic9004@gmail.com> Date: Mon Dec 18 13:34:36 2023 -0700 Merge branch 'guardrails-clean-history' of https://github.com/edilytics/CRISPResso2 into guardrails-clean-history commit 32b49685da320501dad2b0ebbb57887b66220ba8 Author: Samuel Nichols <Snic9004@gmail.com> Date: Fri Dec 15 15:27:04 2023 -0700 Include guardrail functions commit 4e309cf6f732565d635de3d4c5d074ada3027e2d Author: Cole Lyman <cole@colelyman.com> Date: Mon Dec 18 10:51:55 2023 -0700 Refactor to use CRISPRessoReports module commit e648dc087c0055bc5d2fca13c64071a371dea941 Author: Cole Lyman <cole@colelyman.com> Date: Mon Dec 18 10:51:11 2023 -0700 Add CRISPRessoReports subtree commit e948ce107ebb0d1d99010ed12e937f34b5e607d4 Author: Samuel Nichols <Snic9004@gmail.com> Date: Fri Dec 15 15:27:04 2023 -0700 Include guardrail functions commit d33c748871a625facfe8d792e29c77ab9779138f Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Nov 7 16:31:06 2023 -0700 Include parameter --assign_ambiguous_alignments_to_first_reference in readme commit a1435f7f491a6a61434f3051e39f39a4c9bf1edc Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed Oct 11 17:17:30 2023 -0600 Enable quantification by sgRNA (#348) This PR includes: - storing the sgRNA-specific editing locations in the crispresso2_info object. Previously, each amplicon would record the indices of quantification windows across the guide, but not for individual guides. This stores the information for each guide in crispresso2_info['results']['refs'][reference_name]['sgRNA_include_idxs'] - a script (count_sgRNA_specific_edits.py) to parse through an allele table output from a completed CRISPResso run (`--write_detailed_allele_table` flag required) to count edits in each sgRNA separately. I don't have a good double-edited sample handy, but it can be run on the demo HDR data [hdr.fastq.gz](http://crispresso.pinellolab.org/static/demo/hdr.fastq.gz) using the command: ``` CRISPResso -r1 hdr.fastq.gz -a acatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgTggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttggtatcaaggtta -e acatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcaCctgactccGgaggagaagtctgccgttactgcGctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttggtatcaaggtta -c atggtgcatctgactcctgTggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcag -g TGCACCATGGTGTCTGTTTG,GATGAAGTTGGTGGTGAGGCCC --write_detailed_allele_table -n hdr3 -p max -gn guide1,guide2 ``` ``` python CRISPResso2/scripts/count_sgRNA_specific_edits.py -f CRISPResso_on_hdr3 ``` This produces: ``` Processed 25000 alleles Reference: Reference (2391/23415 modified reads) UNMODIFIED: 21024 MODIFIED guide1: 2359 MODIFIED guide2: 32 Reference: HDR (856/1577 modified reads) UNMODIFIED: 721 MODIFIED guide1: 854 MODIFIED guide1 + guide2: 1 MODIFIED guide2: 1 ``` commit 2e3da02fdbed2fa8ae02a277763d65a502459827 Author: Cole Lyman <Cole@colelyman.com> Date: Tue Oct 10 15:29:08 2023 -0600 changed tuple to list for matplotlib change (#31) (#346) Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com> commit cd3c332135fe4db0f9218e3d87263d5c65838ed9 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sun Oct 1 01:54:46 2023 -0600 rename script to camel case commit 7c719d65fb36ac7654db9040f226564ea28fcab9 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sun Oct 1 01:53:44 2023 -0600 Add new script for counting high quality bases commit f97cd2795e89464bcc9321ccfdbca3e6af2bcb4f Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Sep 14 15:15:30 2023 -0600 Prime editing alignment params (#336) Adds two parameters to control alignment of pegRNA components: --prime_editing_gap_open_penalty and --prime_editing_gap_extend_penalty. CRISPResso checks to see whether the pegRNA spacer and extension sequence are in the correct orientation, but sometimes they could align in the incorrect orientation with a higher score (e.g. via insertion of multiple gaps, whereas a single long gap would be preferred). Introducing these two parameters allows users to adjust the alignment parameters specifically for these prime-editing checks without adjusting the global alignment parameters which will be applied to reads that are aligned to the WT reference/prime-editing reference sequences. The new prime_editing_gap_open_penalty is set to -50, a higher gap open penalty than the default needleman_wunsch_gap_open penalty (-20). This commit breaks backward-reproducibility, but mostly in the checking of pegRNA component orientation - so previously some CRISPResso runs would have failed and produced an error, but now they will (hopefully) succeed. To achieve complete backward reproducibility, add the flag --prime_editing_gap_open_penalty -20 to runs. commit 64cbf36dae85cffa2c15e73f2a7ee8aa1077d917 Author: Cole Lyman <Cole@colelyman.com> Date: Thu Sep 7 16:43:30 2023 -0600 Fix samtools piping (#325) * Remove samtools pipe stderr to stdout Sometimes some of the libraries that samtools depends on don't have the correct version information, and as such samtools will report this to stderr when run. Because we pipe the output of samtools, we expect it to be valid SAM format, but when these library version messages are reported, it breaks CRISPRessoWGS. * Remove extra spacing at end of lines and add missing comma in WGS * Log stderr from samtools in CRISPRessoWGS commit 8feff4101f27406d9d88ace97d31a518276bff3f Author: Cole Lyman <Cole@colelyman.com> Date: Fri Sep 1 09:43:56 2023 -0600 Replace link to CRISPResso schematic with raw URL in README (#329) * Replace link to CRISPResso schematic with raw URL * Add new lines to the beginning of unordered lists commit 2e9e6bff5bcc536d5e2ba1440d1ab96d9d47efd6 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Aug 10 00:52:12 2023 -0600 Try to unbreak CircleCI commit ae5b95246cb0f6d66c4cbfb50cf8f5a9626b0827 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Aug 10 00:17:27 2023 -0600 Center command line text messages commit 4d9c71ecf2248c9bb1e10430178dc318b6621c8b Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Aug 10 00:17:07 2023 -0600 Fix bug in prime-editing scaffold-incorporation plotting If read is too short, scaffold incorporation detection will fail because it will check beyond the length of the read. commit 2b36a1a5c35e8a93516ce8baf464595615e0f402 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed Aug 9 15:29:48 2023 -0600 CRISPRessoPooled --compile_postrun_references bug fixes commit 3e04d1d402bcf95edd39fc7c8c9af61bb380f9db Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Aug 8 23:30:15 2023 -0600 Fix missing ' in Pooled --demultiplex_only_at_amplicons commit 06af527f9e2020c5cf251e7f1cec0b1eca1c1664 Author: Cole Lyman <Cole@colelyman.com> Date: Mon Jul 24 10:47:46 2023 -0600 Sort pandas dataframes by # of reads and sequences so that the order is consistent (#316) * Make sorting stable * Including c files * Sort by #Reads instead of %Reads to avoid floating point errors --------- Co-authored-by: Samuel Nichols <Snic9004@gmail.com> commit de05533b3511a84f3b6b14fc2ef64db041613261 Author: Cole Lyman <Cole@colelyman.com> Date: Thu Jul 6 13:54:45 2023 -0600 Fix multiprocessing lambda pickling (#311) * Fix running plots in parallel The reason the plots were running slower before this change is because I was calling the plot function, not passing it to `submit`. So it was essentially running in serial, but worse because it was still spinning up/down the processes. * Fix multiprocessing lambda pickling (#20) * Refactor process_futures to be a dict This makes debugging much easier because you can associate the arguments to the future with the results. * Fix the pickling error when running in multiprocessing Only top-level functions (not lambdas) can be pickled to use in multiprocessing pools, thus the lambdas are converted to a regular function. * Further fixes to pickling multiprocessing error (#21) * Refactor process_futures to be a dict This makes debugging much easier because you can associate the arguments to the future with the results. * Fix the pickling error when running in multiprocessing Only top-level functions (not lambdas) can be pickled to use in multiprocessing pools, thus the lambdas are converted to a regular function. * Use Counter instead of defaultdict in CRISPRessoCORE * Update process_futures to dict in Batch and Aggregate commit ebb016dff46c280dce8c3c09e8ac0e0cc25d4d74 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Jul 3 17:12:09 2023 -0600 Enable CRISPRessoPooled multiprocessing when os allows multi-thread file append commit 7285da0e987b77b72c8885bb35940e0f50c146bd Author: Kendell Clement <k.clement.dev@gmail.com> Date: Fri Jun 23 16:50:33 2023 -0600 Fix print bug for invalid fastq commit 9acdeac67441f9a1d55ac94b153bcb68fb89b92c Author: kclem <k.clement.dev@gmail.com> Date: Wed Jun 21 16:03:48 2023 -0600 Slugify before creating filename - replaces invalid characters in batch names with _ commit f97e29c67de4c80b8d6b9cf334f363be4b514ade Author: Cole Lyman <Cole@colelyman.com> Date: Wed Jun 21 14:43:43 2023 -0600 Add verbosity argument to CRISPRessoAggregate (#18) fixes #306 (#307) * Add verbosity argument to CRISPRessoAggregate (#18) * Allow for amplicon and guide seqs to be some variant of NA in batch (#19) This was discovered when attempting to infer amplicon sequences in batch mode on the web interface, NAs were supplied for the amplicon sequences to the sub CRISPResso commands. commit 32e1e9797da5c3033cdc588e92f06b8813961953 Author: Mark Clement <u0351481@notchpeak30.int.chpc.utah.edu> Date: Wed Jun 21 14:01:00 2023 -0600 Allow for interrogation of overlapping sgRNA sites commit 7248ba8c4deee125ad1ec12fdf1294a84d5f6f93 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Jun 12 12:16:47 2023 -0600 Check input fastq file format Asserts input format of fastq files - including if gzipped files are missing the gz suffix. commit 83c8ab8f462e7d8c1d04c08c1a398b874f517251 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Jun 5 13:41:55 2023 -0600 Fix CRISPRessoArgParser commit 14a2c8577f566e1b72d5f4e72cd6cd22079610be Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Jun 5 13:29:31 2023 -0600 Cosmetic updates for command-line use - version bump to 2.2.13 - If no args are provided, the command line version will print out an abbreviated help message - parameters can be excluded from CRISPRessoArgParser commit 1cd54bc1d03360c3d8121ba9e66b3589fe1cf252 Author: Cole Lyman <Cole@colelyman.com> Date: Thu May 11 14:31:47 2023 -0600 Fix multiprocessing error, don't start pool when only using single thread (#302) * Update README to have consistent use of `--base_editor_output` (#16) * Add files via upload * Only start process pools when using multiple processes This is mainly to solve the issue when running on AWS Lambda, but this should improve single core performance overall. --------- Co-authored-by: Kendell Clement <k.clement.dev@gmail.com> commit 92a705c939b370373a70cf6ae9f1616de33288b9 Author: Cole Lyman <Cole@colelyman.com> Date: Thu May 11 14:31:06 2023 -0600 Update `base_editor` parameters in README and add Plot Harness (#301) * Update README to have consistent use of `--base_editor_output` (#16) * Add files via upload --------- Co-authored-by: Kendell Clement <k.clement.dev@gmail.com> commit 7d46c4490235df45c5546b1b470e4e6a99727031 Author: Cole Lyman <Cole@colelyman.com> Date: Wed May 10 15:41:33 2023 -0600 Clarify CRISPRessoWGS intended use (#303) * Update README to have consistent use of `--base_editor_output` (#16) * Add sample plotting jupyter notebook * Add clarifying info to CRISPRessoWGS description Clarify WGS usage commit 833a701787bb47674b3e921c38cac6189c775cf7 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu May 4 17:02:46 2023 -0400 Remove debug print statements commit 712eb2a11825e8d36f2870deb12b35486bd633fb Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu May 4 16:40:07 2023 -0400 Allow dashes in filenames resolve #73 commit a439f094745b2b5e7f032f0777d4c67e6d6f93c5 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sat Apr 22 23:41:58 2023 -0400 Raise exceptions from within futures in plot_pool commit 7e807a60de2a9d18bccd034b87106ceaf7153338 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sat Apr 22 23:38:56 2023 -0400 Fix future pandas indexing warning Pandas error was "FutureWarning: Calling float on a single element Series is deprecated and will raise a TypeError in the future. Use float(ser.iloc[0]) instead" commit 304a92aa7a7ef8c705cb070dce25d9a2e5745ba9 Author: Cole Lyman <Cole@colelyman.com> Date: Thu Apr 20 13:59:27 2023 -0600 Remove debug print statements fixes #295 (#297) The format string option used here is only available in Python version >=3.8. commit 478c06f784603e96d20f96e91993fdcc4ac35c8a Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Apr 13 12:09:26 2023 -0400 Update plotCustomAllelePlot.py script for #292 (#293) Update type of 'max_rows' param to int Fix location of 'args' in crispresso2_info object commit bcdae39e05d530f4a4e78738c3b30f7664981919 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Mar 27 13:18:34 2023 -0400 Update pooled parameter format commit 546446e36e7e68b527767d6c31ec341a49df2059 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Feb 14 16:26:23 2023 -0500 Fix running plots in parallel (#286) The reason the plots were running slower before this change is because I was calling the plot function, not passing it to `submit`. So it was essentially running in serial, but worse because it was still spinning up/down the processes. Co-authored-by: Cole Lyman <cole@colelyman.com> commit d75f32a2eb5aeaaee866c09e5655a3e27af8b1a1 Author: kclem <k.clement.dev@gmail.com> Date: Fri Feb 10 15:45:15 2023 -0500 Fix #283 to avoid filename collisions Previously, amplicon names longer than 21bp were truncated, but the check for uniqueness wasn't working, so it would overwrite some plot files. This fixes the filename collision and enforces uniqueness in reference filename prefixes. Thanks @mbiokyle29 commit e577318006cd17b2725bd028e5e56634c6eb829a Author: kclem <k.clement.dev@gmail.com> Date: Mon Feb 6 16:37:25 2023 -0500 Case-insensitive headers accepted in CRISPRessoPooled commit d34927620a4a6126a9988b3041e76f60728abbfe Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Jan 31 13:48:33 2023 -0500 Fix print statement in CORE commit ee88b7ed89c395f68225a50dea44a2ad69d5e9a5 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Jan 31 13:22:51 2023 -0500 Version bump to 2.2.12 commit 1d4679c72d0c8b4154317c9aff5179217198e2d7 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Jan 31 13:01:31 2023 -0500 Status Updates + Pooled Mixed Mode Update (#279) * Implement logging handler to overwrite the latest log status to file * Add StatusHandler to CRISPRessoCORE log This will take the latest log output and write it to a file (`status.txt`), the catch being that with each log the file is overwritten so that one can easily tell where CRISPResso currently is and what the error is (if any). These changes include some slight refactoring in order to accomodate any potential parameter exceptions. * Add StatusHandler to CRISPRessoBatch and refactor `logger.warn` to `warn` * Add StatusHandler to CRISPRessoPooled and a little refactoring * Implement `percent_complete` to the status log * Add StatusHandler to CRISPRessoAggregate log * Add StatusHandler to CRISPRessoCompare log * Add StatusHandler to CRISPRessoPooledWGSCompare log * Add StatusHandler to CRISPRessoWGS log * Rename `status.txt` to `CRISPResso_status.txt` * Modify status log names to match the tool they are generated from * Add percent_complete stages to CRISPRessoCORE These also include log statements of each plot that is being generated as well as fixing some variable name collisions with `ind`. * Format the percentage in the log to be 2 decimal places * Change all plotting logs from `info` to `debug` and simplify progress This refactors how the progress of the plots is calculated, making it much simplier. Before this change we would of had to keep track of the number of times `percent_complete` was output, but now it simply updates the percent complete after each amplicon is finished processing. Hopefully this will make things easier to mantain even though it will be a little less "accurate" (not sure how accurate the original implementation was...). * Implemented shared console log handler across all CRISPResso* calls This allows for easy changes to logging formatting, which was inspired by having to change the default logging level. The default logging level needs to be set at `logging.DEBUG` in order for the debug log statements to not be ignored for the running and status logs. * Add ability to set the verbosity level to each CRISPResso* tool This allows users to set a verbosity level between 1 and 4 using the `-v`/`--verbosity` CLI parameter. If the `--debug` flag is present, then the level will default to 4, being the most verbose. * Implement showing the last seen `percent_compelte` when none is provided * Keep track of and log when multiple parallel runs are completed These changes modify `CRISPRessoMultiProcessing.run_crispresso_cmds` such that we can now display when a run is completed. This potentially breaks how signals and interupts are handled with multiple runs happening, but this needs to be reviewed. * Add debug and percentage complete to CRISPRessoBatch * Add percent complete to CRISPRessoPooled * Add debug and percent_complete message to CRISPRessoAggregate * Add `percent_complete` to CRISPRessoCompare * Add `percent_complete` to CRISPRessoPooledWGSCompare * Add status and `percent_complete` to CRISPRessoMeta * Add `verbosity` arguments to CRISPRessoCompare and CRISPRessoPooledWGSCompare * Fixing documentation to match pooled headers * Header removal bug fix change documentation to guide_seq * Update documentation and help feature for CRISPRessoPooled * Remove extra newlines from CRISPRessoPooled -h * Make variable names as clear as my firstborn child's name * Update one more variable name * Fix bug to flow CRISPRessoPooled options to sub command * Make amplicon file args variable name clear * Update how parameters are set and retrieved from parameter object The refactor in the previous commit changed the type of the arguments to a dictionary which doesn't have the parameters as attributes, and this commit fixes that error. * Add note in output header for change in default CRISPRessoPooled In the next release (2.3.0) the `--demultiplex_only_at_amplicons` will be the default when running in mixed-mode. This is to allow for inexact alignments of the reads and the amplicons to the genome. For more context, see this issue https://github.com/pinellolab/CRISPResso2/issues/276 * Clarify the verbosity parameter help message * Separate out parameters to `normalize_name` in CRISPRessoCORE * Separate out parameters to `normalize_name` in CRISPRessoWGS * Separate out parameters to `normalize_name` in CRISPRessoPooled * Separate out parameters to `normalize_name` in CRISPRessoCompare * Fix bug in CRISPRessoPooled by replacing `database_id` with `normalize_name` * Refactor `run_crispresso_cmds` to not require a `logger` This commit implements the functionality to make the `logger` object optional by seeing which module called the `run_crispresso_cmds` function and obtaining the correct object from that module name. The function also immediately returns when no commands are passed to it. * Add amplicon name to plotting debug statements in CRISPRessoCORE --------- Co-authored-by: Cole Lyman <cole@coles-mbp-2.lan> Co-authored-by: Cole Lyman <cole@Coles-MacBook-Pro-2.local> Co-authored-by: Cole Lyman <cole@colelyman.com> Co-authored-by: Samuel Nichols <Snic9004@gmail.com> commit ff7eca76e6a3a08af4ac18ac4e88d20f2a06b1f9 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jan 26 15:27:27 2023 -0500 CRISPRessoPooled custom header fix (#278) * Fixing documentation to match pooled headers * Header removal bug fix change documentation to guide_seq * Update documentation and help feature for CRISPRessoPooled * Remove extra newlines from CRISPRessoPooled -h * Make variable names as clear as my firstborn child's name * Update one more variable name Co-authored-by: Samuel Nichols <Snic9004@gmail.com> commit 104866e1080c973bb025d1a5ba59b19dca1658af Author: Cole Lyman <Cole@colelyman.com> Date: Thu Jan 5 14:00:26 2023 -0700 Fix deprecated numpy type names (fixes #269) (#270) In the most recent version of numpy (1.24) some of the types have been deprecated. This commit fixes these errors. commit 58a8e42df88b66fad6b4f6ad04a5b9d9d43d01b4 Author: Cole Lyman <Cole@colelyman.com> Date: Thu Jan 5 06:49:35 2023 -0700 Add snippet about installing CRISPResso2 via bioconda on Apple silicon (#274) I have suffered enough trying to debug my installation, so hopefully this helps someone else. Co-authored-by: Cole Lyman <cole@coles-mbp-2.lan> commit b9851e98104602eb78c2b384105267624295e9d3 Author: Cole Lyman <Cole@colelyman.com> Date: Thu Dec 22 13:30:23 2022 -0700 Fix bug when pooled bam is input (#265) This change checks to see if a bam file was input, and if so it doesn't try to remove any intermediate files because there aren't any. Co-authored-by: Cole Lyman <cole@coles-mbp-2.lan> commit b822612642043e75a19042941f69b457ce51f517 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Dec 19 15:26:45 2022 -0500 Delete vscode settings commit b99aa624dec68ef7d19264340ce0cafa829625f4 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Dec 19 13:29:14 2022 -0500 Clarify input param help for pooled bam commit 3fae1e8b821ec6b1890bff6561fa8fa67dc49a04 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Dec 19 13:28:54 2022 -0500 Fix #235 - Cigar string is * if read unaligned Previously, the bam would set the cigar string to 0 if the read was unaligned. This breaks the sam->bam conversion and causes the errors in #235. commit c65ba07dc5a983453cdf7bb1e27005230dac6f1b Author: Cole Lyman <Cole@colelyman.com> Date: Thu Dec 8 13:48:17 2022 -0700 Add deprecation notice (#260) * Add FLASh and Trimmomatic deprecation notice to CLI output * Add Edilytics email address to CLI output commit 2a30e5a45f5350ee7c6435bce1cd4edc4d31668a Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Dec 6 12:16:19 2022 -0500 Format filterReadsOnSequencePresence script commit 9d764414edd88a46ad5e4f496e4f1c8d5d60ce3e Author: Kendell Clement <k.clement.dev@gmail.com> Date: Fri Dec 2 22:12:54 2022 -0500 Clarify default CRISPRessoPooled settings for use_legacy_bowtie2_options_string commit 9ddea40f7f02b546941ddaa4c71fc5283075051a Author: kclem <k.clement.dev@gmail.com> Date: Mon Nov 14 10:33:04 2022 -0500 Add check for prime editing extension sequence in prime edited sequence if the user specifies the prime_editing_override_prime_edited_ref_seq, it could not contain the extension seq (if they don't provide the extension seq in the appropriate orientation), so check that here. Extension sequence should be provided reverse-complement to the prime edited sequence. commit 152f2dd5001da7090641ee8a1326bde9f7e8104e Author: kclem <k.clement.dev@gmail.com> Date: Wed Nov 9 11:53:41 2022 -0500 Version bump to 2.2.11a commit 9ed356e3a0c6c316d0860d121772f80ddca6de1d Author: kclem <k.clement.dev@gmail.com> Date: Wed Nov 9 11:47:30 2022 -0500 Add param to override prime editing sequence checks CRISPResso checks that prime editing guides are provided in the proper orientation (e.g. pegRNA 3'->5', spacer sequence 5'->3') and checks these orientations by alignment. Sometimes, the alignment can be better in the opposite direction, and this parameter allows these checks to be overridden. Otherwise, these checks would halt the program and produce the output 'The prime editing pegRNA spacer sequence appears to be given in the 3\'->5\' order. The prime editing pegRNA spacer sequence (--prime_editing_pegRNA_spacer_seq) must be given in the RNA 5\'->3\' order.' commit 39dd80afb98a22b7edb6f801c363d86bb77eeb5b Author: kclem <k.clement.dev@gmail.com> Date: Wed Nov 9 10:06:51 2022 -0500 Update filterReadsOnSequencePresence.py commit fe55526927e3fb6e17c9a8a6f59c7057bc1e14eb Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Nov 7 22:25:16 2022 -0500 Add script to filter input based on sequence presence commit 713e57a19c35180035ca35e11a5820065eda0198 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Oct 18 16:02:26 2022 -0400 Allow spaces in read names for CRISPRessoWGS commit 39ce008bdddccdd8229c0ba185dce78bc2f66968 Author: Cole Lyman <Cole@colelyman.com> Date: Sat Oct 8 21:09:58 2022 -0600 Fix typo of CRISPResssoPlot when plotting nucleotide quilt (#250) commit 6a2b342c8503b7327c0a2414edfbd16912d60ca5 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sat Oct 8 23:08:47 2022 -0400 Batch amplicon plots (#251) * Error out if HDR amplicon matches existing amplicon * Add check for amplicon sequence uniqueness * Fix bug with bam_input not having bam_output * Test for no returned lines in auto mode, version bump to 2.2.11 * Fix pandas deprecation of df.append commit 726b2b93d6e419a1b0aa6a968c97edc55b4cc5a8 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Oct 6 16:32:02 2022 -0400 Fix CRISPRessoBatch plot pool bug when plots are suppressed commit 7e5049c4dfb88cbc87c91935a91d1f51120a10c2 Author: Cole Lyman <Cole@colelyman.com> Date: Wed Sep 21 21:04:51 2022 -0600 Fix batch quilt plot name (#249) This fixes an incorrectly named allele quilt plot input in CRISPRessoBatch. commit 1821ca5029c5a1485733f13ab3f2048b4f1fa04e Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Sep 15 15:49:08 2022 -0400 Version bump to 2.2.10 commit c5f79aebfc1ae209f4ee320df250eed89a02787c Author: Cole Lyman <Cole@colelyman.com> Date: Wed Sep 14 14:24:55 2022 -0600 Parallel plot refactor (#247) * Fix duplicate plotting in CRISPRessoBatch aggregate * Refactor mulltiprocessing plots in CRISPRessoBatch * Refactor multiprocessing plots in CRISPRessoCORE * Refactor multiprocessing plots for CRISPRessoAggregate commit 4ed5e24e6cc1dd8068e2391573ae2438acd32db2 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Sep 13 14:12:11 2022 -0400 print files in curr dir if Aggregate can't find files commit ce25bc06f29988e7a10afd0b6a09ba0caf0950e0 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Sep 12 10:32:57 2022 -0400 Spelling typo commit c15f01c75083403f17c58c121b2afe97e9f2a1ec Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Sep 6 17:49:52 2022 -0400 Add helper function to create alignment scoring matrix New scoring matrix can be created using CRISPResso2Align.make_matrix() commit c80f82838c5a228b79ad4484092877cfee08e02c Author: Cole Lyman <Cole@colelyman.com> Date: Mon Aug 22 18:28:33 2022 -0600 Add `zip_output` (#240) * Making zip of results * Zip command added, if zip is true place_report_in_output_folder is also true, zip removes all files while zipping * Adding --zip to compare and pooled/wgs compare * Add more formatting changes to CRISPRessoShared * Refactoring propagate_crispress_options so only one version exists * Zip added to arguments_to_ignore and warning added when changing arguments * Restore styling * Update README to include --zip * Rename --zip to --zip_output * Change --zip to --zip_output in CompareCORE and PooledWGSCompareCORE * Bug fix arg to args Co-authored-by: Samuel Nichols <Snic9004@gmail.com> commit 5de3d7286d8e33c7cf4d3615fce715806e72f511 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Aug 11 21:42:34 2022 -0400 Fix fix to aggregate for CRISPRessoWGS commit a2294c266f43b14969a5d6474076f31a77a57173 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Aug 11 21:40:50 2022 -0400 Fix bug in aggregate for WGS commit 7ce3eb4abe4b8ceac933272ac9cb16a8bedf26a3 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Aug 8 21:53:45 2022 -0400 Update CRISPRessoWGS to allow non-word characters in region names commit 040ac0033d6e250f4e3a412101874cf5e914e08a Author: kclem <k.clement.dev@gmail.com> Date: Mon Aug 8 16:04:59 2022 -0400 Enable processing of cram files by CRISPRessoWGS Adds --reference to samtools view when viewing cram files commit cf112a0caba8789e28530cc09171285ec6ea9b4c Author: kclem <k.clement.dev@gmail.com> Date: Mon Aug 8 14:55:46 2022 -0400 Auto amplicon detection for interleaved input Enables processing of interleaved fastq files for guess_guides and guess_amplicons, as well as get_most_frequent_reads. When interleaved input is present, the input is first separated into R1/R2 files, then processing is performed. commit 4ba524dc7b947feca8a0f743837844f9febc2171 Author: Cole Lyman <Cole@colelyman.com> Date: Thu Aug 4 11:32:11 2022 -0600 Potential fix for aggregate plots in Batch mode (#237) commit 6097a8a104d3f156ef7c08e196ac37e32bf04c71 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jul 21 22:45:48 2022 -0400 Fix pct_vectors in crispresso2_info json object commit 65a079d86d6f386793397398f839c46014b54543 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed Jul 20 23:46:37 2022 -0400 Fix more readme spelling bugs commit e817376ecd54cdea1f29e303ca25b9e7d1d38333 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed Jul 20 23:42:23 2022 -0400 Fix bug in readme spelling commit 49740ba1d66ed6d13a9e154b8b17bc8b5186581d Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed Jul 20 16:10:09 2022 -0400 Fix loading of crispresso info from WGS and Pooled commit b68a43271115251b18e8955e285ccc18f549e8cd Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jul 14 14:11:04 2022 -0400 Add plotly to dockerfile commit b0b7d41d697304d0d5fc93e3346c9de1b98ba41d Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jul 14 14:10:00 2022 -0400 Fix #231 Allow N's in bam output (Try 2) commit c460b3e73fd06a230dbac2e37c86b833144ebf94 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jul 14 14:09:10 2022 -0400 Revert "Fix #231 Allow N's in bam output" This reverts commit 2f6ad1dbe05210af9ccc1b1f17783cd212a888d3. commit 2f6ad1dbe05210af9ccc1b1f17783cd212a888d3 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jul 14 13:52:37 2022 -0400 Fix #231 Allow N's in bam output commit 0a2419e518dc9b3520058c3927f98b31cd51347e Author: Cole Lyman <Cole@colelyman.com> Date: Fri Jul 8 21:10:01 2022 -0600 Fix bug when name is provided instead of amplicon_name in pooled input file (#229) Also, raise an exception (instead of incorrectly executing) when there are not enough matched parameters in the pooled input file. commit cb58212379803788c04ca5793baaa760cbbeaa81 Author: Cole Lyman <Cole@colelyman.com> Date: Fri Jul 8 21:09:49 2022 -0600 Fix bug when comparing two samples with the same name. (#228) commit e8a796f5f451409cbafed4404dfba4b6b8a124ca Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jun 23 21:30:23 2022 -0400 Version bump to 2.2.9 commit 632143ddedea48bab9229baeb4bf3ea4d1f658d6 Author: Cole Lyman <Cole@colelyman.com> Date: Mon Jun 20 19:53:14 2022 -0600 Don't run global frameshift plot when there are no reads (#226) When there are no reads (i.e. global_MODIFIED_FRAMESHIFT + global_MODIFIED_NON_FRAMESHIFT + global_NON_MODIFIED_NON_FRAMESHIFT == 0) there was a bug when trying to compute the pie chart, because all of the values in the pie chart are 0. This fix, will make sure that there is at least one read in order for the plot to bee constructed properly. commit 4bb06218e835d2624d53fd401542caef6f8a3a55 Author: kclem <k.clement.dev@gmail.com> Date: Fri Jun 3 16:57:02 2022 -0400 Improvements for guide inference in 'auto' mode In 'auto' mode, a putative guide sequence is selected at the site of maximal editing. If the site of maximal editing happens near the end of the guide (e.g. base 0) many things will break (e.g. quantification windows, etc). This update excludes bases from being used to find the guide using the --exclude_bp_from_left and --exclude_bp_from_right parameters. At default, these parameters are 15bp, so the first and last 15bp would not be selected for the site of maximal editing and thus be the site of a guide sequence. In addition, the site of maximal editing must have 3x the magnitude over the background. commit 9d64de187835b2553ad2b4374d32edab27f83645 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jun 2 20:22:25 2022 -0400 Update README.md commit 6aafc5387986f5089ba55b68d128343d68052792 Author: Simon P Shen <sshen8@users.noreply.github.com> Date: Tue May 31 17:42:53 2022 -0400 directory in quotes in batch cmd (#222) Add quotes around output folder for folders that have spaces. commit 432f163ac68b9a650d1fd326171aadc505ee87f4 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue May 24 23:38:36 2022 -0400 CRISPRessoBatch fills NA values in batch settings NA values in CRISPRessoBatch are filled with the value from args - either the default value or the value from the command line args (if set) commit 6de774adbad3aa8cd99d07b0ba7692984b356cd4 Author: kclem <k.clement.dev@gmail.com> Date: Mon May 23 14:18:02 2022 -0400 Fix file naming bug for HDR outputs In html file, figures 4e and 4f incorrectly referenced figure 4d. This fixes this bug. commit b88fec0668a4082a12ead3d26582e86d829dd7cc Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sat May 21 00:32:15 2022 -0400 For bam_output, fix bug that wrote unaligned lines twice commit 3564e77ebcdedb4b01cc01dcca18ba3221fac67c Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu May 19 16:32:18 2022 -0400 Update README with CRISPRessoPooled headers and bam_output parameters commit bc08d81f17cb1929d1c37a1773cffcf36fb12fe2 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu May 19 16:11:30 2022 -0400 Add more links to tools commit 006c497a379ecd94b017a883a5db887861e1586a Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu May 19 16:08:14 2022 -0400 Add links to tools commit dc8243373ad00d6bd467fc30c59942596ff0c5d6 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon May 16 21:38:06 2022 -0400 fastq_to_bam implementation (#219) commit e88b6833977c6b2768299e0b2e7af623e3a9ae7c Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sun May 8 02:14:13 2022 -0400 Fix bug for when guides don't agree in CRISPRessoAggregate commit 7eb763116a8c60603f1cd654645215767ee8eb52 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu May 5 03:28:21 2022 -0400 Fix bug for case of empty summary plots in report generation commit 0324fa67d14ed945f0c9531d9bcf73ebcf4ca042 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu May 5 03:28:02 2022 -0400 Create report for number of significant bases in CRISPRessoCompare commit e3c9d0026a9ee6732f3ed6bdcf2a824850d7e66a Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 22:43:11 2022 -0400 Update pickle to json in readme and CRISPRessoPooledWGSCompare commit 1553f7977c12bf1091a20ca55b878bccfb739b61 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 18:10:04 2022 -0400 Merge pull request #4 from pinellolab/master (#218) commit bcecbfc047d294e26f381a6668e08cb4db24445c Merge: 15b0e05b bb13e007 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 18:06:37 2022 -0400 Merge branch 'master' into master commit bb13e007738d6e7a4909e01f03daff592f334f36 Merge: af4ab6e8 d0b41483 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 17:59:32 2022 -0400 Merge branch 'master' of https://github.com/edilytics/CRISPResso2 commit 15b0e05b9e03bbec5236e58776ddf9aa2f93180e Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 17:54:52 2022 -0400 2 flexible pooled input (#217) * Batch type coerce and r2 file check * Upgrade tabs for bootstrap5 * Update readme with additional pooled amplicon file headers Co-authored-by: Samuel Nichols <Snic9004@gmail.com> commit d0b41483bee704940ba60c58289f412b04c71659 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 13:43:43 2022 -0400 Update README.md commit ce49fab5301cb73ba0daf6c765e350eb083c76f1 Merge: 5f909713 b913fcb4 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 13:40:30 2022 -0400 Merge pull request #3 from edilytics/2-flexible-pooled-input Add flexibility to CRISPRessoPooled amplicon input by allowing headers. Also, prime editing and quantification window coordinate parameters can be passed to CRISPRessoPooled. commit b913fcb402a8ba3106c3ff7913563a33d8d19fca Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 13:38:25 2022 -0400 Update CRISPRessoPooledCORE.py Replace process to read header, increase flexibility for column order commit 945bf31f16530b7ce25b89095b2c7005bf146117 Merge: 7b8f6788 5f909713 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 12:45:24 2022 -0400 Merge branch 'master' into 2-flexible-pooled-input commit 5f9097133765736a7c2fe3c8e9b730845fed0b70 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 12:23:44 2022 -0400 Version bump to 2.2.8 commit c4a94ce0e06c6ebae13e128fbe6b708e635121c4 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 00:13:17 2022 -0400 Fix summary plot representation for multi reports *fixed old reference to make_multi_report which called old summary plot format * renamed summary_plot to summary_plots to reflect a dict with multiple plots commit 62900e9ae6fa37ce99a04f12a63ed5c912f75042 Author: Cole Lyman <Cole@colelyman.com> Date: Tue May 3 20:47:52 2022 -0600 Large aggregation (#192) * Squashed commit of the following: commit 8564eb03f0d9e62abf4b7528baf5c2ae296be8f9 Merge: f6ef62c 07cc7d8 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Jan 11 16:20:15 2022 -0500 Merge branch 'indel-alignment-fix' of https://github.com/edilytics/CRISPResso2 into indel-alignment-fix commit 07cc7d856ab3fcbbaa5381f17f29568192388887 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:29:59 2021 -0700 Fix bug in `find_indels_substitutions` This bug occurred when there was a deletion at the end of a sequence, and was thus not properly accounted for. commit f6ef62cfdf909adac1b10ea86555cd218f8b2a74 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:29:59 2021 -0700 Fix bug in `find_indels_substitutions` This bug occurred when there was a deletion at the end of a sequence, and was thus not properly accounted for. commit 7212f87f4be60057a6c848947ff6b5efde132a25 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:26:17 2021 -0700 Add a unit test for `find_indels_substitutions` This unit test checks for deletions at the end of a sequence, which are inherently outside of the include_indx_set window. commit d50b4e903b973c71a275e31d470b40e59280ee13 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:03:22 2021 -0700 Fix a bug in `find_indels_substitutions` The bug that this commit fixes is when an insertion occurs at the edge of the include indexes. The trouble with this earlier was that it was using the `idx` to calculate the size of the insertion, but the `idx` wasn't being incremented anymore because it was outside of the include window. commit 4db066f7bc333b7662a9232ac732ebb33ac3ace8 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:01:39 2021 -0700 Add test case for `find_indels_substitutions` This test case is extracted from the CRISPRessoBatch integration test and provides an example where there is an insertion at the edge of the include index. commit 3b3a7417f5bbd6c2785a2af54a47e01d2e820451 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 11:37:07 2021 -0700 Fix bug in CRISPRessoCompare where sample names were not properly set This was a place where it was (partially) missed during the crispresso2_info object refactoring. commit e9f5eff3d95b676b5ee2e23371a5604f600d34b2 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:26:17 2021 -0700 Add a unit test for `find_indels_substitutions` This unit test checks for deletions at the end of a sequence, which are inherently outside of the include_indx_set window. commit d4d45a918254ab19a7e7956e9e731389c6f36ecb Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:03:22 2021 -0700 Fix a bug in `find_indels_substitutions` The bug that this commit fixes is when an insertion occurs at the edge of the include indexes. The trouble with this earlier was that it was using the `idx` to calculate the size of the insertion, but the `idx` wasn't being incremented anymore because it was outside of the include window. commit 13f00bb40239c83e6e5cf844561fdb7000d3d9ab Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:01:39 2021 -0700 Add test case for `find_indels_substitutions` This test case is extracted from the CRISPRessoBatch integration test and provides an example where there is an insertion at the edge of the include index. commit 659ae34e8fd106f7ecc163b5bea0b5a80ab0283c Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 11:37:07 2021 -0700 Fix bug in CRISPRessoCompare where sample names were not properly set This was a place where it was (partially) missed during the crispresso2_info object refactoring. * Add parameter `--suppress_batch_summary_plots` If many runs are run at the same time, batch summary plots may fail because they are too large for matplotlib. This parameter `--suppress_batch_summary_plots` allows individual runs to be plotted, but suppresses batch summary plots that may otherwise be too big. * Pep formatting cleanup * Add summary nucleotide plots to aggregate * Aggregate plots are paginated * Update CRISPRessoAggregateCORE.py Remove max sample limit for plotting * Add --max_samples_per_summary_plot to CRISPRessoAggregate Parameterize the max number of samples to plot on each page of reports. Additional PDFs will be created with this number of samples on them. * Add plotly function to plot an interactive heatmap * Fix deprecated numpy type to suppress warning * Add plotting of heatmaps to CRISPRessoAggregateCORE to summarize modification types These heatmaps are interactive (zoomable and panable) and show for each sample the percentage of insertions, substitutions, and deletions. * Add the heatmap summaries to the CRISPRessoAggregate report * Update Bootstrap to 5.1.3 This is mainly so that we can use the fullscreen modal functionality in this version. * Move the plotly heatmaps to a Bootstrap modal * Fix bug where plots were not filling up entire modal. I have tried countless different ways for this to work, and this is the best that I can come up with. After the modal is opened it triggers the plot to resize, and then for some reason you need to trigger the resize event. I think this is because a `div` changing size won't actually trigger the resizing of the plot (and neither will just calling `Plotly.Plots.resize`...?!). * Update the axis labels and add autosize to plotly heatmaps I'm pretty sure the autosize doesn't do anything, but it is there for good measure. * Abandon attempts to make plots fullscreen This includes removing the Bootstrap modal (two out of the three plots would resize properly and I couldn't figure out a way to have the plot displayed outside of the modal). I have left in some javascript to make the plot fullscreen, but I couldn't get the formatting quite right and the plot wasn't much bigger in the fullscreen version because there was a ton of space between the plot and the heatmap. If some brave soul would like to tackle it, feel free! * Rename and refactor how plot data is passed around I have consolidated how the plot data is passed around, so that now you can pass in only one dict with all of the information instead of 4 or 5 separate parameters. I also renamed the `heatmap_plot_*` to `allele_modification_heatmap_*`. * Implement the line plot version of the modification percentages This also includes correctly resizing the plot when the line plot tab is selected! * Change default `max_samples_per_summary_plot` to be 150 instead of 250 * Remove extra assignments of `this_number_samples` and suppress plot The plot that is suppressed is the large nucleotide quilt when there is a large number of samples. Is it okay to suppress this plot @kclem? * Implement parallel plotting in CRISPRessoAggregate * Fix sample indexing error and heatmap scaling for large number of samples * Add parameter `--suppress_batch_summary_plots` If many runs are run at the same time, batch summary plots may fail because they are too large for matplotlib. This parameter `--suppress_batch_summary_plots` allows individual runs to be plotted, but suppresses batch summary plots that may otherwise be too big. * Pep formatting cleanup * Add summary nucleotide plots to aggregate * Aggregate plots are paginated * Update CRISPRessoAggregateCORE.py Remove max sample limit for plotting * Add --max_samples_per_summary_plot to CRISPRessoAggregate Parameterize the max number of samples to plot on each page of reports. Additional PDFs will be created with this number of samples on them. * Add plotly function to plot an interactive heatmap * Fix deprecated numpy type to suppress warning * Add plotting of heatmaps to CRISPRessoAggregateCORE to summarize modification types These heatmaps are interactive (zoomable and panable) and show for each sample the percentage of insertions, substitutions, and deletions. * Add the heatmap summaries to the CRISPRessoAggregate report * Update Bootstrap to 5.1.3 This is mainly so that we can use the fullscreen modal functionality in this version. * Move the plotly heatmaps to a Bootstrap modal * Fix bug where plots were not filling up entire modal. I have tried countless different ways for this to work, and this is the best that I can come up with. After the modal is opened it triggers the plot to resize, and then for some reason you need to trigger the resize event. I think this is because a `div` changing size won't actually trigger the resizing of the plot (and neither will just calling `Plotly.Plots.resize`...?!). * Update the axis labels and add autosize to plotly heatmaps I'm pretty sure the autosize doesn't do anything, but it is there for good measure. * Abandon attempts to make plots fullscreen This includes removing the Bootstrap modal (two out of the three plots would resize properly and I couldn't figure out a way to have the plot displayed outside of the modal). I have left in some javascript to make the plot fullscreen, but I couldn't get the formatting quite right and the plot wasn't much bigger in the fullscreen version because there was a ton of space between the plot and the heatmap. If some brave soul would like to tackle it, feel free! * Rename and refactor how plot data is passed around I have consolidated how the plot data is passed around, so that now you can pass in only one dict with all of the information instead of 4 or 5 separate parameters. I also renamed the `heatmap_plot_*` to `allele_modification_heatmap_*`. * Implement the line plot version of the modification percentages This also includes correctly resizing the plot when the line plot tab is selected! * Change default `max_samples_per_summary_plot` to be 150 instead of 250 * Remove extra assignments of `this_number_samples` and suppress plot The plot that is suppressed is the large nucleotide quilt when there is a large number of samples. Is it okay to suppress this plot @kclem? * Implement parallel plotting in CRISPRessoAggregate * Fix sample indexing error and heatmap scaling for large number of samples * Add plotly requrement to setup.py * Remove space around vertical barcharts * Add scrollbar to long images in multiReport * Fill in default (empty) values to allele modification plots When not running CRISPRessoAggregate, default values for the `allele_modification_heatmap_plot` and `allele_modification_lin_plot` dictionaries will be set so that the template can be properly rendered. * Include CRISPRessoBatch in the refactor of how summary_plot dicts are handled * Update dockerfile for new docker * minor bug fixes for plotCustomAllelePlot.py to work with Python3 (#212) * Allow for flexible parsing of quant window coordinates * CRISPRessoPooled debug flash command, fix pep formatting * Set flexiguide homology parameter type to int * Coerce ints in batch file checking (#200) * Batch type coerce and r2 file check * Revert "Batch type coerce and r2 file check" This reverts commit f91736688ea9739cf3063e3601c52ad6da1116a4. * Coerce int values * Handle multiple qwcs in batch mode If multiple qwcs were provided in batch mode, a parsing error would occur. This fixes this bug. * Fix bug from old pandas for int cols Evidently old pandas versions throw an error if a column doesn't exist. This checks to see if the column exists before the values are set. * Create allele modification heatmaps and line plots in CRISPRessoBatch * Add allele modification heatmaps and line plots to CRISPRessoBatch * Make all plots in CRISPRessoBatch run in parallel * Make `--suppress_batch_summary_plots` store true Also, only open and shutdown the process pool when necessary. * Add blank values for allele_modification entries when not present Co-authored-by: Kendell Clement <k.clement.dev@gmail.com> Co-authored-by: dharjanto <dewi.harjanto@gmail.com> Co-authored-by: Samuel Nichols <Snic9004@gmail.com> commit f67376fc9ab0e407d4086aa42fd1c77706ebc9c0 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Fri Apr 15 00:46:30 2022 -0400 Fix bug from old pandas for int cols Evidently old pandas versions throw an error if a column doesn't exist. This checks to see if the column exists before the values are set. commit b34fe2956ff88629809b2434878028723dfc4895 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Apr 14 23:58:07 2022 -0400 Handle multiple qwcs in batch mode If multiple qwcs were provided in batch mode, a parsing error would occur. This fixes this bug. commit c94e3b9f2e301bda91e9c1e6f4ef794b33b5dbf0 Author: Samuel Nichols <Snic9004@gmail.com> Date: Thu Apr 14 21:48:32 2022 -0600 Coerce ints in batch file checking (#200) * Batch type coerce and r2 file check * Revert "Batch type coerce and r2 file check" This reverts commit f91736688ea9739cf3063e3601c52ad6da1116a4. * Coerce int values commit fc4542491bb86eb143db0044a848a56234403496 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Apr 14 22:13:23 2022 -0400 Set flexiguide homology parameter type to int commit 23fe2aa8e26067d1bcf36bfafc67e023c7588d2f Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Apr 14 22:12:37 2022 -0400 CRISPRessoPooled debug flash command, fix pep formatting commit d292d33d8c1fa3bfd2cee656643fd47bcdab161d Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Apr 14 22:00:19 2022 -0400 Allow for flexible parsing of quant window coordinates commit e1667cb53a7ea6fbb33369c8530a78639ed423ec Author: dharjanto <dewi.harjanto@gmail.com> Date: Mon Apr 11 22:08:21 2022 -0400 minor bug fixes for plotCustomAllelePlot.py to work with Python3 (#212) commit 7b8f6788da18f6ab173fa3c3d10f4ab6bb2acc26 Author: Samuel Nichols <Snic9004@gmail.com> Date: Fri Apr 8 10:21:00 2022 -0600 Update README commit 9bc24cd0474ed9f398dff64274d3181c4b2f8637 Author: Samuel Nichols <Snic9004@gmail.com> Date: Tue Mar 29 11:25:09 2022 -0600 Using Amplicon_Name commit 88ac5d72074b3da63de035e02c911ce34cd29414 Merge: b6057a2d e5afa478 Author: Samuel Nichols <Snic9004@gmail.com> Date: Mon Mar 28 22:32:09 2022 -0600 Merge remote-tracking branch 'origin/master' into 2-flexible-pooled-input commit b6057a2d54cb8637ff0900416de8e2de72213f76 Author: Samuel Nichols <Snic9004@gmail.com> Date: Mon Mar 28 20:53:05 2022 -0600 Printing info statements for matched headers commit af4ab6e8507d7aa4b7b68f217a458e0d9c966f55 Merge: bbb7d6f0 51a943c3 Author: Cole Lyman <Cole@colelyman.com> Date: Fri Mar 25 09:44:13 2022 -0600 Merge branch 'pinellolab:master' into master commit 3c1eb012fc02563e3e963f17a62c7e932f5bcddc Author: Samuel Nichols <Snic9004@gmail.com> Date: Thu Mar 24 12:31:43 2022 -0600 Debugging and column checking commit 0b47acbc592a6df6adf14641357b2104b76be691 Author: Samuel Nichols <Snic9004@gmail.com> Date: Wed Mar 23 09:42:51 2022 -0600 New variables added to pooled commit a0ff3a44d6d19d7b37f91919b5c0180206f72d53 Author: Samuel Nichols <Snic9004@gmail.com> Date: Mon Mar 21 09:32:28 2022 -0600 Read as string not bytes commit 710675fc3c0307e21103abd604315b47ff80a894 Author: Samuel Nichols <Snic9004@gmail.com> Date: Wed Mar 16 13:51:30 2022 -0600 Adding command building for new options commit f386818a48e5c840bd567611e6f1320c8146cac7 Author: Samuel Nichols <Snic9004@gmail.com> Date: Wed Mar 16 10:08:33 2022 -0600 Comment out df_template.iloc instance commit eb5e309da57c8b96cd760728ddbf67be05f30d1c Author: Samuel Nichols <Snic9004@gmail.com> Date: Wed Mar 16 09:59:19 2022 -0600 Potential solution for flexible headers commit 51a943c3a8f8181963acc420e75a5e8ee103cf7c Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Mar 15 11:00:46 2022 -0400 CRISPRessoPooled pep formatting and fix CRISPRessoPooled doesn't re-count reads if it has been run once and the `aligned_pooled_bam` is provided as input pep code formatting changes commit bbb7d6f0907aa13518d20e7f470e7de518b825f4 Merge: ddbd39f0 5a10d638 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Mar 15 10:23:38 2022 -0400 Merge branch 'master' of https://github.com/edilytics/CRISPResso2 commit 5a10d638c638f21f8a2934955e92ef7e117b889e Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sat Feb 26 14:21:57 2022 -0500 Move metadata for bam input and output commit e5afa4784d5330a1dc95c5deafcd9217edeac631 Author: Samuel Nichols <Snic9004@gmail.com> Date: Wed Feb 16 10:20:24 2022 -0700 Coerce int values commit ede7d85b50055311908000578c76a1860ae9de4d Author: Samuel Nichols <Snic9004@gmail.com> Date: Wed Feb 16 10:18:29 2022 -0700 Revert "Batch type coerce and r2 file check" This reverts commit f91736688ea9739cf3063e3601c52ad6da1116a4. commit f91736688ea9739cf3063e3601c52ad6da1116a4 Author: Samuel Nichols <Snic9004@gmail.com> Date: Wed Feb 16 10:10:52 2022 -0700 Batch type coerce and r2 file check commit 7b4a310b0f8b64c00e02eca3d522ad50d39b43ae Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Feb 15 22:18:05 2022 -0500 Reiterate WGS region file is tab-separated Add note to WGS description that region file should be tab-separated. Closes #199 commit b8497542e388ad401d0815d426f27abc3201a76d Author: kclem <k.clement.dev@gmail.com> Date: Fri Feb 11 15:07:14 2022 -0500 Extend x-axis to longest scaffold incorporation length commit ab7248947afade089809c74bfe6e9d5394e8f6dc Author: kclem <k.clement.dev@gmail.com> Date: Wed Feb 9 17:05:11 2022 -0500 Fix prime editing indexing for plots commit ddbd39f06b262d5ebd2cc69e116c08b22b6bd84e Merge: a7ffd468 442a48c7 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jan 13 15:35:36 2022 -0500 Merge branch 'pinellolab:master' into master …
Snicker7
added a commit
to edilytics/CRISPResso2
that referenced
this pull request
Apr 4, 2024
commit 22fc03183a8070c30dfb74d5c23575ac19019855 Author: Samuel Nichols <Snic9004@gmail.com> Date: Fri Jan 12 08:54:01 2024 -0700 Add guardrail partial commit e55f6b21972b578261bc5a864ce1d653d98f9e34 Author: Samuel Nichols <Snic9004@gmail.com> Date: Mon Jan 8 07:50:59 2024 -0700 Functional guardrails, needs reports update commit 6e968e9699ed59a47d88191d03768e042d8b60a4 Merge: 32b49685 e948ce10 Author: Samuel Nichols <Snic9004@gmail.com> Date: Mon Dec 18 13:34:36 2023 -0700 Merge branch 'guardrails-clean-history' of https://github.com/edilytics/CRISPResso2 into guardrails-clean-history commit 32b49685da320501dad2b0ebbb57887b66220ba8 Author: Samuel Nichols <Snic9004@gmail.com> Date: Fri Dec 15 15:27:04 2023 -0700 Include guardrail functions commit 4e309cf6f732565d635de3d4c5d074ada3027e2d Author: Cole Lyman <cole@colelyman.com> Date: Mon Dec 18 10:51:55 2023 -0700 Refactor to use CRISPRessoReports module commit e648dc087c0055bc5d2fca13c64071a371dea941 Author: Cole Lyman <cole@colelyman.com> Date: Mon Dec 18 10:51:11 2023 -0700 Add CRISPRessoReports subtree commit e948ce107ebb0d1d99010ed12e937f34b5e607d4 Author: Samuel Nichols <Snic9004@gmail.com> Date: Fri Dec 15 15:27:04 2023 -0700 Include guardrail functions commit d33c748871a625facfe8d792e29c77ab9779138f Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Nov 7 16:31:06 2023 -0700 Include parameter --assign_ambiguous_alignments_to_first_reference in readme commit a1435f7f491a6a61434f3051e39f39a4c9bf1edc Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed Oct 11 17:17:30 2023 -0600 Enable quantification by sgRNA (#348) This PR includes: - storing the sgRNA-specific editing locations in the crispresso2_info object. Previously, each amplicon would record the indices of quantification windows across the guide, but not for individual guides. This stores the information for each guide in crispresso2_info['results']['refs'][reference_name]['sgRNA_include_idxs'] - a script (count_sgRNA_specific_edits.py) to parse through an allele table output from a completed CRISPResso run (`--write_detailed_allele_table` flag required) to count edits in each sgRNA separately. I don't have a good double-edited sample handy, but it can be run on the demo HDR data [hdr.fastq.gz](http://crispresso.pinellolab.org/static/demo/hdr.fastq.gz) using the command: ``` CRISPResso -r1 hdr.fastq.gz -a acatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgTggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttggtatcaaggtta -e acatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcaCctgactccGgaggagaagtctgccgttactgcGctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttggtatcaaggtta -c atggtgcatctgactcctgTggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcag -g TGCACCATGGTGTCTGTTTG,GATGAAGTTGGTGGTGAGGCCC --write_detailed_allele_table -n hdr3 -p max -gn guide1,guide2 ``` ``` python CRISPResso2/scripts/count_sgRNA_specific_edits.py -f CRISPResso_on_hdr3 ``` This produces: ``` Processed 25000 alleles Reference: Reference (2391/23415 modified reads) UNMODIFIED: 21024 MODIFIED guide1: 2359 MODIFIED guide2: 32 Reference: HDR (856/1577 modified reads) UNMODIFIED: 721 MODIFIED guide1: 854 MODIFIED guide1 + guide2: 1 MODIFIED guide2: 1 ``` commit 2e3da02fdbed2fa8ae02a277763d65a502459827 Author: Cole Lyman <Cole@colelyman.com> Date: Tue Oct 10 15:29:08 2023 -0600 changed tuple to list for matplotlib change (#31) (#346) Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com> commit cd3c332135fe4db0f9218e3d87263d5c65838ed9 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sun Oct 1 01:54:46 2023 -0600 rename script to camel case commit 7c719d65fb36ac7654db9040f226564ea28fcab9 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sun Oct 1 01:53:44 2023 -0600 Add new script for counting high quality bases commit f97cd2795e89464bcc9321ccfdbca3e6af2bcb4f Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Sep 14 15:15:30 2023 -0600 Prime editing alignment params (#336) Adds two parameters to control alignment of pegRNA components: --prime_editing_gap_open_penalty and --prime_editing_gap_extend_penalty. CRISPResso checks to see whether the pegRNA spacer and extension sequence are in the correct orientation, but sometimes they could align in the incorrect orientation with a higher score (e.g. via insertion of multiple gaps, whereas a single long gap would be preferred). Introducing these two parameters allows users to adjust the alignment parameters specifically for these prime-editing checks without adjusting the global alignment parameters which will be applied to reads that are aligned to the WT reference/prime-editing reference sequences. The new prime_editing_gap_open_penalty is set to -50, a higher gap open penalty than the default needleman_wunsch_gap_open penalty (-20). This commit breaks backward-reproducibility, but mostly in the checking of pegRNA component orientation - so previously some CRISPResso runs would have failed and produced an error, but now they will (hopefully) succeed. To achieve complete backward reproducibility, add the flag --prime_editing_gap_open_penalty -20 to runs. commit 64cbf36dae85cffa2c15e73f2a7ee8aa1077d917 Author: Cole Lyman <Cole@colelyman.com> Date: Thu Sep 7 16:43:30 2023 -0600 Fix samtools piping (#325) * Remove samtools pipe stderr to stdout Sometimes some of the libraries that samtools depends on don't have the correct version information, and as such samtools will report this to stderr when run. Because we pipe the output of samtools, we expect it to be valid SAM format, but when these library version messages are reported, it breaks CRISPRessoWGS. * Remove extra spacing at end of lines and add missing comma in WGS * Log stderr from samtools in CRISPRessoWGS commit 8feff4101f27406d9d88ace97d31a518276bff3f Author: Cole Lyman <Cole@colelyman.com> Date: Fri Sep 1 09:43:56 2023 -0600 Replace link to CRISPResso schematic with raw URL in README (#329) * Replace link to CRISPResso schematic with raw URL * Add new lines to the beginning of unordered lists commit 2e9e6bff5bcc536d5e2ba1440d1ab96d9d47efd6 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Aug 10 00:52:12 2023 -0600 Try to unbreak CircleCI commit ae5b95246cb0f6d66c4cbfb50cf8f5a9626b0827 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Aug 10 00:17:27 2023 -0600 Center command line text messages commit 4d9c71ecf2248c9bb1e10430178dc318b6621c8b Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Aug 10 00:17:07 2023 -0600 Fix bug in prime-editing scaffold-incorporation plotting If read is too short, scaffold incorporation detection will fail because it will check beyond the length of the read. commit 2b36a1a5c35e8a93516ce8baf464595615e0f402 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed Aug 9 15:29:48 2023 -0600 CRISPRessoPooled --compile_postrun_references bug fixes commit 3e04d1d402bcf95edd39fc7c8c9af61bb380f9db Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Aug 8 23:30:15 2023 -0600 Fix missing ' in Pooled --demultiplex_only_at_amplicons commit 06af527f9e2020c5cf251e7f1cec0b1eca1c1664 Author: Cole Lyman <Cole@colelyman.com> Date: Mon Jul 24 10:47:46 2023 -0600 Sort pandas dataframes by # of reads and sequences so that the order is consistent (#316) * Make sorting stable * Including c files * Sort by #Reads instead of %Reads to avoid floating point errors --------- Co-authored-by: Samuel Nichols <Snic9004@gmail.com> commit de05533b3511a84f3b6b14fc2ef64db041613261 Author: Cole Lyman <Cole@colelyman.com> Date: Thu Jul 6 13:54:45 2023 -0600 Fix multiprocessing lambda pickling (#311) * Fix running plots in parallel The reason the plots were running slower before this change is because I was calling the plot function, not passing it to `submit`. So it was essentially running in serial, but worse because it was still spinning up/down the processes. * Fix multiprocessing lambda pickling (#20) * Refactor process_futures to be a dict This makes debugging much easier because you can associate the arguments to the future with the results. * Fix the pickling error when running in multiprocessing Only top-level functions (not lambdas) can be pickled to use in multiprocessing pools, thus the lambdas are converted to a regular function. * Further fixes to pickling multiprocessing error (#21) * Refactor process_futures to be a dict This makes debugging much easier because you can associate the arguments to the future with the results. * Fix the pickling error when running in multiprocessing Only top-level functions (not lambdas) can be pickled to use in multiprocessing pools, thus the lambdas are converted to a regular function. * Use Counter instead of defaultdict in CRISPRessoCORE * Update process_futures to dict in Batch and Aggregate commit ebb016dff46c280dce8c3c09e8ac0e0cc25d4d74 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Jul 3 17:12:09 2023 -0600 Enable CRISPRessoPooled multiprocessing when os allows multi-thread file append commit 7285da0e987b77b72c8885bb35940e0f50c146bd Author: Kendell Clement <k.clement.dev@gmail.com> Date: Fri Jun 23 16:50:33 2023 -0600 Fix print bug for invalid fastq commit 9acdeac67441f9a1d55ac94b153bcb68fb89b92c Author: kclem <k.clement.dev@gmail.com> Date: Wed Jun 21 16:03:48 2023 -0600 Slugify before creating filename - replaces invalid characters in batch names with _ commit f97e29c67de4c80b8d6b9cf334f363be4b514ade Author: Cole Lyman <Cole@colelyman.com> Date: Wed Jun 21 14:43:43 2023 -0600 Add verbosity argument to CRISPRessoAggregate (#18) fixes #306 (#307) * Add verbosity argument to CRISPRessoAggregate (#18) * Allow for amplicon and guide seqs to be some variant of NA in batch (#19) This was discovered when attempting to infer amplicon sequences in batch mode on the web interface, NAs were supplied for the amplicon sequences to the sub CRISPResso commands. commit 32e1e9797da5c3033cdc588e92f06b8813961953 Author: Mark Clement <u0351481@notchpeak30.int.chpc.utah.edu> Date: Wed Jun 21 14:01:00 2023 -0600 Allow for interrogation of overlapping sgRNA sites commit 7248ba8c4deee125ad1ec12fdf1294a84d5f6f93 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Jun 12 12:16:47 2023 -0600 Check input fastq file format Asserts input format of fastq files - including if gzipped files are missing the gz suffix. commit 83c8ab8f462e7d8c1d04c08c1a398b874f517251 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Jun 5 13:41:55 2023 -0600 Fix CRISPRessoArgParser commit 14a2c8577f566e1b72d5f4e72cd6cd22079610be Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Jun 5 13:29:31 2023 -0600 Cosmetic updates for command-line use - version bump to 2.2.13 - If no args are provided, the command line version will print out an abbreviated help message - parameters can be excluded from CRISPRessoArgParser commit 1cd54bc1d03360c3d8121ba9e66b3589fe1cf252 Author: Cole Lyman <Cole@colelyman.com> Date: Thu May 11 14:31:47 2023 -0600 Fix multiprocessing error, don't start pool when only using single thread (#302) * Update README to have consistent use of `--base_editor_output` (#16) * Add files via upload * Only start process pools when using multiple processes This is mainly to solve the issue when running on AWS Lambda, but this should improve single core performance overall. --------- Co-authored-by: Kendell Clement <k.clement.dev@gmail.com> commit 92a705c939b370373a70cf6ae9f1616de33288b9 Author: Cole Lyman <Cole@colelyman.com> Date: Thu May 11 14:31:06 2023 -0600 Update `base_editor` parameters in README and add Plot Harness (#301) * Update README to have consistent use of `--base_editor_output` (#16) * Add files via upload --------- Co-authored-by: Kendell Clement <k.clement.dev@gmail.com> commit 7d46c4490235df45c5546b1b470e4e6a99727031 Author: Cole Lyman <Cole@colelyman.com> Date: Wed May 10 15:41:33 2023 -0600 Clarify CRISPRessoWGS intended use (#303) * Update README to have consistent use of `--base_editor_output` (#16) * Add sample plotting jupyter notebook * Add clarifying info to CRISPRessoWGS description Clarify WGS usage commit 833a701787bb47674b3e921c38cac6189c775cf7 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu May 4 17:02:46 2023 -0400 Remove debug print statements commit 712eb2a11825e8d36f2870deb12b35486bd633fb Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu May 4 16:40:07 2023 -0400 Allow dashes in filenames resolve #73 commit a439f094745b2b5e7f032f0777d4c67e6d6f93c5 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sat Apr 22 23:41:58 2023 -0400 Raise exceptions from within futures in plot_pool commit 7e807a60de2a9d18bccd034b87106ceaf7153338 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sat Apr 22 23:38:56 2023 -0400 Fix future pandas indexing warning Pandas error was "FutureWarning: Calling float on a single element Series is deprecated and will raise a TypeError in the future. Use float(ser.iloc[0]) instead" commit 304a92aa7a7ef8c705cb070dce25d9a2e5745ba9 Author: Cole Lyman <Cole@colelyman.com> Date: Thu Apr 20 13:59:27 2023 -0600 Remove debug print statements fixes #295 (#297) The format string option used here is only available in Python version >=3.8. commit 478c06f784603e96d20f96e91993fdcc4ac35c8a Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Apr 13 12:09:26 2023 -0400 Update plotCustomAllelePlot.py script for #292 (#293) Update type of 'max_rows' param to int Fix location of 'args' in crispresso2_info object commit bcdae39e05d530f4a4e78738c3b30f7664981919 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Mar 27 13:18:34 2023 -0400 Update pooled parameter format commit 546446e36e7e68b527767d6c31ec341a49df2059 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Feb 14 16:26:23 2023 -0500 Fix running plots in parallel (#286) The reason the plots were running slower before this change is because I was calling the plot function, not passing it to `submit`. So it was essentially running in serial, but worse because it was still spinning up/down the processes. Co-authored-by: Cole Lyman <cole@colelyman.com> commit d75f32a2eb5aeaaee866c09e5655a3e27af8b1a1 Author: kclem <k.clement.dev@gmail.com> Date: Fri Feb 10 15:45:15 2023 -0500 Fix #283 to avoid filename collisions Previously, amplicon names longer than 21bp were truncated, but the check for uniqueness wasn't working, so it would overwrite some plot files. This fixes the filename collision and enforces uniqueness in reference filename prefixes. Thanks @mbiokyle29 commit e577318006cd17b2725bd028e5e56634c6eb829a Author: kclem <k.clement.dev@gmail.com> Date: Mon Feb 6 16:37:25 2023 -0500 Case-insensitive headers accepted in CRISPRessoPooled commit d34927620a4a6126a9988b3041e76f60728abbfe Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Jan 31 13:48:33 2023 -0500 Fix print statement in CORE commit ee88b7ed89c395f68225a50dea44a2ad69d5e9a5 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Jan 31 13:22:51 2023 -0500 Version bump to 2.2.12 commit 1d4679c72d0c8b4154317c9aff5179217198e2d7 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Jan 31 13:01:31 2023 -0500 Status Updates + Pooled Mixed Mode Update (#279) * Implement logging handler to overwrite the latest log status to file * Add StatusHandler to CRISPRessoCORE log This will take the latest log output and write it to a file (`status.txt`), the catch being that with each log the file is overwritten so that one can easily tell where CRISPResso currently is and what the error is (if any). These changes include some slight refactoring in order to accomodate any potential parameter exceptions. * Add StatusHandler to CRISPRessoBatch and refactor `logger.warn` to `warn` * Add StatusHandler to CRISPRessoPooled and a little refactoring * Implement `percent_complete` to the status log * Add StatusHandler to CRISPRessoAggregate log * Add StatusHandler to CRISPRessoCompare log * Add StatusHandler to CRISPRessoPooledWGSCompare log * Add StatusHandler to CRISPRessoWGS log * Rename `status.txt` to `CRISPResso_status.txt` * Modify status log names to match the tool they are generated from * Add percent_complete stages to CRISPRessoCORE These also include log statements of each plot that is being generated as well as fixing some variable name collisions with `ind`. * Format the percentage in the log to be 2 decimal places * Change all plotting logs from `info` to `debug` and simplify progress This refactors how the progress of the plots is calculated, making it much simplier. Before this change we would of had to keep track of the number of times `percent_complete` was output, but now it simply updates the percent complete after each amplicon is finished processing. Hopefully this will make things easier to mantain even though it will be a little less "accurate" (not sure how accurate the original implementation was...). * Implemented shared console log handler across all CRISPResso* calls This allows for easy changes to logging formatting, which was inspired by having to change the default logging level. The default logging level needs to be set at `logging.DEBUG` in order for the debug log statements to not be ignored for the running and status logs. * Add ability to set the verbosity level to each CRISPResso* tool This allows users to set a verbosity level between 1 and 4 using the `-v`/`--verbosity` CLI parameter. If the `--debug` flag is present, then the level will default to 4, being the most verbose. * Implement showing the last seen `percent_compelte` when none is provided * Keep track of and log when multiple parallel runs are completed These changes modify `CRISPRessoMultiProcessing.run_crispresso_cmds` such that we can now display when a run is completed. This potentially breaks how signals and interupts are handled with multiple runs happening, but this needs to be reviewed. * Add debug and percentage complete to CRISPRessoBatch * Add percent complete to CRISPRessoPooled * Add debug and percent_complete message to CRISPRessoAggregate * Add `percent_complete` to CRISPRessoCompare * Add `percent_complete` to CRISPRessoPooledWGSCompare * Add status and `percent_complete` to CRISPRessoMeta * Add `verbosity` arguments to CRISPRessoCompare and CRISPRessoPooledWGSCompare * Fixing documentation to match pooled headers * Header removal bug fix change documentation to guide_seq * Update documentation and help feature for CRISPRessoPooled * Remove extra newlines from CRISPRessoPooled -h * Make variable names as clear as my firstborn child's name * Update one more variable name * Fix bug to flow CRISPRessoPooled options to sub command * Make amplicon file args variable name clear * Update how parameters are set and retrieved from parameter object The refactor in the previous commit changed the type of the arguments to a dictionary which doesn't have the parameters as attributes, and this commit fixes that error. * Add note in output header for change in default CRISPRessoPooled In the next release (2.3.0) the `--demultiplex_only_at_amplicons` will be the default when running in mixed-mode. This is to allow for inexact alignments of the reads and the amplicons to the genome. For more context, see this issue https://github.com/pinellolab/CRISPResso2/issues/276 * Clarify the verbosity parameter help message * Separate out parameters to `normalize_name` in CRISPRessoCORE * Separate out parameters to `normalize_name` in CRISPRessoWGS * Separate out parameters to `normalize_name` in CRISPRessoPooled * Separate out parameters to `normalize_name` in CRISPRessoCompare * Fix bug in CRISPRessoPooled by replacing `database_id` with `normalize_name` * Refactor `run_crispresso_cmds` to not require a `logger` This commit implements the functionality to make the `logger` object optional by seeing which module called the `run_crispresso_cmds` function and obtaining the correct object from that module name. The function also immediately returns when no commands are passed to it. * Add amplicon name to plotting debug statements in CRISPRessoCORE --------- Co-authored-by: Cole Lyman <cole@coles-mbp-2.lan> Co-authored-by: Cole Lyman <cole@Coles-MacBook-Pro-2.local> Co-authored-by: Cole Lyman <cole@colelyman.com> Co-authored-by: Samuel Nichols <Snic9004@gmail.com> commit ff7eca76e6a3a08af4ac18ac4e88d20f2a06b1f9 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jan 26 15:27:27 2023 -0500 CRISPRessoPooled custom header fix (#278) * Fixing documentation to match pooled headers * Header removal bug fix change documentation to guide_seq * Update documentation and help feature for CRISPRessoPooled * Remove extra newlines from CRISPRessoPooled -h * Make variable names as clear as my firstborn child's name * Update one more variable name Co-authored-by: Samuel Nichols <Snic9004@gmail.com> commit 104866e1080c973bb025d1a5ba59b19dca1658af Author: Cole Lyman <Cole@colelyman.com> Date: Thu Jan 5 14:00:26 2023 -0700 Fix deprecated numpy type names (fixes #269) (#270) In the most recent version of numpy (1.24) some of the types have been deprecated. This commit fixes these errors. commit 58a8e42df88b66fad6b4f6ad04a5b9d9d43d01b4 Author: Cole Lyman <Cole@colelyman.com> Date: Thu Jan 5 06:49:35 2023 -0700 Add snippet about installing CRISPResso2 via bioconda on Apple silicon (#274) I have suffered enough trying to debug my installation, so hopefully this helps someone else. Co-authored-by: Cole Lyman <cole@coles-mbp-2.lan> commit b9851e98104602eb78c2b384105267624295e9d3 Author: Cole Lyman <Cole@colelyman.com> Date: Thu Dec 22 13:30:23 2022 -0700 Fix bug when pooled bam is input (#265) This change checks to see if a bam file was input, and if so it doesn't try to remove any intermediate files because there aren't any. Co-authored-by: Cole Lyman <cole@coles-mbp-2.lan> commit b822612642043e75a19042941f69b457ce51f517 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Dec 19 15:26:45 2022 -0500 Delete vscode settings commit b99aa624dec68ef7d19264340ce0cafa829625f4 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Dec 19 13:29:14 2022 -0500 Clarify input param help for pooled bam commit 3fae1e8b821ec6b1890bff6561fa8fa67dc49a04 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Dec 19 13:28:54 2022 -0500 Fix #235 - Cigar string is * if read unaligned Previously, the bam would set the cigar string to 0 if the read was unaligned. This breaks the sam->bam conversion and causes the errors in #235. commit c65ba07dc5a983453cdf7bb1e27005230dac6f1b Author: Cole Lyman <Cole@colelyman.com> Date: Thu Dec 8 13:48:17 2022 -0700 Add deprecation notice (#260) * Add FLASh and Trimmomatic deprecation notice to CLI output * Add Edilytics email address to CLI output commit 2a30e5a45f5350ee7c6435bce1cd4edc4d31668a Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Dec 6 12:16:19 2022 -0500 Format filterReadsOnSequencePresence script commit 9d764414edd88a46ad5e4f496e4f1c8d5d60ce3e Author: Kendell Clement <k.clement.dev@gmail.com> Date: Fri Dec 2 22:12:54 2022 -0500 Clarify default CRISPRessoPooled settings for use_legacy_bowtie2_options_string commit 9ddea40f7f02b546941ddaa4c71fc5283075051a Author: kclem <k.clement.dev@gmail.com> Date: Mon Nov 14 10:33:04 2022 -0500 Add check for prime editing extension sequence in prime edited sequence if the user specifies the prime_editing_override_prime_edited_ref_seq, it could not contain the extension seq (if they don't provide the extension seq in the appropriate orientation), so check that here. Extension sequence should be provided reverse-complement to the prime edited sequence. commit 152f2dd5001da7090641ee8a1326bde9f7e8104e Author: kclem <k.clement.dev@gmail.com> Date: Wed Nov 9 11:53:41 2022 -0500 Version bump to 2.2.11a commit 9ed356e3a0c6c316d0860d121772f80ddca6de1d Author: kclem <k.clement.dev@gmail.com> Date: Wed Nov 9 11:47:30 2022 -0500 Add param to override prime editing sequence checks CRISPResso checks that prime editing guides are provided in the proper orientation (e.g. pegRNA 3'->5', spacer sequence 5'->3') and checks these orientations by alignment. Sometimes, the alignment can be better in the opposite direction, and this parameter allows these checks to be overridden. Otherwise, these checks would halt the program and produce the output 'The prime editing pegRNA spacer sequence appears to be given in the 3\'->5\' order. The prime editing pegRNA spacer sequence (--prime_editing_pegRNA_spacer_seq) must be given in the RNA 5\'->3\' order.' commit 39dd80afb98a22b7edb6f801c363d86bb77eeb5b Author: kclem <k.clement.dev@gmail.com> Date: Wed Nov 9 10:06:51 2022 -0500 Update filterReadsOnSequencePresence.py commit fe55526927e3fb6e17c9a8a6f59c7057bc1e14eb Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Nov 7 22:25:16 2022 -0500 Add script to filter input based on sequence presence commit 713e57a19c35180035ca35e11a5820065eda0198 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Oct 18 16:02:26 2022 -0400 Allow spaces in read names for CRISPRessoWGS commit 39ce008bdddccdd8229c0ba185dce78bc2f66968 Author: Cole Lyman <Cole@colelyman.com> Date: Sat Oct 8 21:09:58 2022 -0600 Fix typo of CRISPResssoPlot when plotting nucleotide quilt (#250) commit 6a2b342c8503b7327c0a2414edfbd16912d60ca5 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sat Oct 8 23:08:47 2022 -0400 Batch amplicon plots (#251) * Error out if HDR amplicon matches existing amplicon * Add check for amplicon sequence uniqueness * Fix bug with bam_input not having bam_output * Test for no returned lines in auto mode, version bump to 2.2.11 * Fix pandas deprecation of df.append commit 726b2b93d6e419a1b0aa6a968c97edc55b4cc5a8 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Oct 6 16:32:02 2022 -0400 Fix CRISPRessoBatch plot pool bug when plots are suppressed commit 7e5049c4dfb88cbc87c91935a91d1f51120a10c2 Author: Cole Lyman <Cole@colelyman.com> Date: Wed Sep 21 21:04:51 2022 -0600 Fix batch quilt plot name (#249) This fixes an incorrectly named allele quilt plot input in CRISPRessoBatch. commit 1821ca5029c5a1485733f13ab3f2048b4f1fa04e Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Sep 15 15:49:08 2022 -0400 Version bump to 2.2.10 commit c5f79aebfc1ae209f4ee320df250eed89a02787c Author: Cole Lyman <Cole@colelyman.com> Date: Wed Sep 14 14:24:55 2022 -0600 Parallel plot refactor (#247) * Fix duplicate plotting in CRISPRessoBatch aggregate * Refactor mulltiprocessing plots in CRISPRessoBatch * Refactor multiprocessing plots in CRISPRessoCORE * Refactor multiprocessing plots for CRISPRessoAggregate commit 4ed5e24e6cc1dd8068e2391573ae2438acd32db2 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Sep 13 14:12:11 2022 -0400 print files in curr dir if Aggregate can't find files commit ce25bc06f29988e7a10afd0b6a09ba0caf0950e0 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Sep 12 10:32:57 2022 -0400 Spelling typo commit c15f01c75083403f17c58c121b2afe97e9f2a1ec Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Sep 6 17:49:52 2022 -0400 Add helper function to create alignment scoring matrix New scoring matrix can be created using CRISPResso2Align.make_matrix() commit c80f82838c5a228b79ad4484092877cfee08e02c Author: Cole Lyman <Cole@colelyman.com> Date: Mon Aug 22 18:28:33 2022 -0600 Add `zip_output` (#240) * Making zip of results * Zip command added, if zip is true place_report_in_output_folder is also true, zip removes all files while zipping * Adding --zip to compare and pooled/wgs compare * Add more formatting changes to CRISPRessoShared * Refactoring propagate_crispress_options so only one version exists * Zip added to arguments_to_ignore and warning added when changing arguments * Restore styling * Update README to include --zip * Rename --zip to --zip_output * Change --zip to --zip_output in CompareCORE and PooledWGSCompareCORE * Bug fix arg to args Co-authored-by: Samuel Nichols <Snic9004@gmail.com> commit 5de3d7286d8e33c7cf4d3615fce715806e72f511 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Aug 11 21:42:34 2022 -0400 Fix fix to aggregate for CRISPRessoWGS commit a2294c266f43b14969a5d6474076f31a77a57173 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Aug 11 21:40:50 2022 -0400 Fix bug in aggregate for WGS commit 7ce3eb4abe4b8ceac933272ac9cb16a8bedf26a3 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Aug 8 21:53:45 2022 -0400 Update CRISPRessoWGS to allow non-word characters in region names commit 040ac0033d6e250f4e3a412101874cf5e914e08a Author: kclem <k.clement.dev@gmail.com> Date: Mon Aug 8 16:04:59 2022 -0400 Enable processing of cram files by CRISPRessoWGS Adds --reference to samtools view when viewing cram files commit cf112a0caba8789e28530cc09171285ec6ea9b4c Author: kclem <k.clement.dev@gmail.com> Date: Mon Aug 8 14:55:46 2022 -0400 Auto amplicon detection for interleaved input Enables processing of interleaved fastq files for guess_guides and guess_amplicons, as well as get_most_frequent_reads. When interleaved input is present, the input is first separated into R1/R2 files, then processing is performed. commit 4ba524dc7b947feca8a0f743837844f9febc2171 Author: Cole Lyman <Cole@colelyman.com> Date: Thu Aug 4 11:32:11 2022 -0600 Potential fix for aggregate plots in Batch mode (#237) commit 6097a8a104d3f156ef7c08e196ac37e32bf04c71 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jul 21 22:45:48 2022 -0400 Fix pct_vectors in crispresso2_info json object commit 65a079d86d6f386793397398f839c46014b54543 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed Jul 20 23:46:37 2022 -0400 Fix more readme spelling bugs commit e817376ecd54cdea1f29e303ca25b9e7d1d38333 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed Jul 20 23:42:23 2022 -0400 Fix bug in readme spelling commit 49740ba1d66ed6d13a9e154b8b17bc8b5186581d Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed Jul 20 16:10:09 2022 -0400 Fix loading of crispresso info from WGS and Pooled commit b68a43271115251b18e8955e285ccc18f549e8cd Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jul 14 14:11:04 2022 -0400 Add plotly to dockerfile commit b0b7d41d697304d0d5fc93e3346c9de1b98ba41d Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jul 14 14:10:00 2022 -0400 Fix #231 Allow N's in bam output (Try 2) commit c460b3e73fd06a230dbac2e37c86b833144ebf94 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jul 14 14:09:10 2022 -0400 Revert "Fix #231 Allow N's in bam output" This reverts commit 2f6ad1dbe05210af9ccc1b1f17783cd212a888d3. commit 2f6ad1dbe05210af9ccc1b1f17783cd212a888d3 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jul 14 13:52:37 2022 -0400 Fix #231 Allow N's in bam output commit 0a2419e518dc9b3520058c3927f98b31cd51347e Author: Cole Lyman <Cole@colelyman.com> Date: Fri Jul 8 21:10:01 2022 -0600 Fix bug when name is provided instead of amplicon_name in pooled input file (#229) Also, raise an exception (instead of incorrectly executing) when there are not enough matched parameters in the pooled input file. commit cb58212379803788c04ca5793baaa760cbbeaa81 Author: Cole Lyman <Cole@colelyman.com> Date: Fri Jul 8 21:09:49 2022 -0600 Fix bug when comparing two samples with the same name. (#228) commit e8a796f5f451409cbafed4404dfba4b6b8a124ca Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jun 23 21:30:23 2022 -0400 Version bump to 2.2.9 commit 632143ddedea48bab9229baeb4bf3ea4d1f658d6 Author: Cole Lyman <Cole@colelyman.com> Date: Mon Jun 20 19:53:14 2022 -0600 Don't run global frameshift plot when there are no reads (#226) When there are no reads (i.e. global_MODIFIED_FRAMESHIFT + global_MODIFIED_NON_FRAMESHIFT + global_NON_MODIFIED_NON_FRAMESHIFT == 0) there was a bug when trying to compute the pie chart, because all of the values in the pie chart are 0. This fix, will make sure that there is at least one read in order for the plot to bee constructed properly. commit 4bb06218e835d2624d53fd401542caef6f8a3a55 Author: kclem <k.clement.dev@gmail.com> Date: Fri Jun 3 16:57:02 2022 -0400 Improvements for guide inference in 'auto' mode In 'auto' mode, a putative guide sequence is selected at the site of maximal editing. If the site of maximal editing happens near the end of the guide (e.g. base 0) many things will break (e.g. quantification windows, etc). This update excludes bases from being used to find the guide using the --exclude_bp_from_left and --exclude_bp_from_right parameters. At default, these parameters are 15bp, so the first and last 15bp would not be selected for the site of maximal editing and thus be the site of a guide sequence. In addition, the site of maximal editing must have 3x the magnitude over the background. commit 9d64de187835b2553ad2b4374d32edab27f83645 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jun 2 20:22:25 2022 -0400 Update README.md commit 6aafc5387986f5089ba55b68d128343d68052792 Author: Simon P Shen <sshen8@users.noreply.github.com> Date: Tue May 31 17:42:53 2022 -0400 directory in quotes in batch cmd (#222) Add quotes around output folder for folders that have spaces. commit 432f163ac68b9a650d1fd326171aadc505ee87f4 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue May 24 23:38:36 2022 -0400 CRISPRessoBatch fills NA values in batch settings NA values in CRISPRessoBatch are filled with the value from args - either the default value or the value from the command line args (if set) commit 6de774adbad3aa8cd99d07b0ba7692984b356cd4 Author: kclem <k.clement.dev@gmail.com> Date: Mon May 23 14:18:02 2022 -0400 Fix file naming bug for HDR outputs In html file, figures 4e and 4f incorrectly referenced figure 4d. This fixes this bug. commit b88fec0668a4082a12ead3d26582e86d829dd7cc Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sat May 21 00:32:15 2022 -0400 For bam_output, fix bug that wrote unaligned lines twice commit 3564e77ebcdedb4b01cc01dcca18ba3221fac67c Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu May 19 16:32:18 2022 -0400 Update README with CRISPRessoPooled headers and bam_output parameters commit bc08d81f17cb1929d1c37a1773cffcf36fb12fe2 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu May 19 16:11:30 2022 -0400 Add more links to tools commit 006c497a379ecd94b017a883a5db887861e1586a Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu May 19 16:08:14 2022 -0400 Add links to tools commit dc8243373ad00d6bd467fc30c59942596ff0c5d6 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon May 16 21:38:06 2022 -0400 fastq_to_bam implementation (#219) commit e88b6833977c6b2768299e0b2e7af623e3a9ae7c Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sun May 8 02:14:13 2022 -0400 Fix bug for when guides don't agree in CRISPRessoAggregate commit 7eb763116a8c60603f1cd654645215767ee8eb52 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu May 5 03:28:21 2022 -0400 Fix bug for case of empty summary plots in report generation commit 0324fa67d14ed945f0c9531d9bcf73ebcf4ca042 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu May 5 03:28:02 2022 -0400 Create report for number of significant bases in CRISPRessoCompare commit e3c9d0026a9ee6732f3ed6bdcf2a824850d7e66a Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 22:43:11 2022 -0400 Update pickle to json in readme and CRISPRessoPooledWGSCompare commit 1553f7977c12bf1091a20ca55b878bccfb739b61 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 18:10:04 2022 -0400 Merge pull request #4 from pinellolab/master (#218) commit bcecbfc047d294e26f381a6668e08cb4db24445c Merge: 15b0e05b bb13e007 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 18:06:37 2022 -0400 Merge branch 'master' into master commit bb13e007738d6e7a4909e01f03daff592f334f36 Merge: af4ab6e8 d0b41483 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 17:59:32 2022 -0400 Merge branch 'master' of https://github.com/edilytics/CRISPResso2 commit 15b0e05b9e03bbec5236e58776ddf9aa2f93180e Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 17:54:52 2022 -0400 2 flexible pooled input (#217) * Batch type coerce and r2 file check * Upgrade tabs for bootstrap5 * Update readme with additional pooled amplicon file headers Co-authored-by: Samuel Nichols <Snic9004@gmail.com> commit d0b41483bee704940ba60c58289f412b04c71659 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 13:43:43 2022 -0400 Update README.md commit ce49fab5301cb73ba0daf6c765e350eb083c76f1 Merge: 5f909713 b913fcb4 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 13:40:30 2022 -0400 Merge pull request #3 from edilytics/2-flexible-pooled-input Add flexibility to CRISPRessoPooled amplicon input by allowing headers. Also, prime editing and quantification window coordinate parameters can be passed to CRISPRessoPooled. commit b913fcb402a8ba3106c3ff7913563a33d8d19fca Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 13:38:25 2022 -0400 Update CRISPRessoPooledCORE.py Replace process to read header, increase flexibility for column order commit 945bf31f16530b7ce25b89095b2c7005bf146117 Merge: 7b8f6788 5f909713 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 12:45:24 2022 -0400 Merge branch 'master' into 2-flexible-pooled-input commit 5f9097133765736a7c2fe3c8e9b730845fed0b70 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 12:23:44 2022 -0400 Version bump to 2.2.8 commit c4a94ce0e06c6ebae13e128fbe6b708e635121c4 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 00:13:17 2022 -0400 Fix summary plot representation for multi reports *fixed old reference to make_multi_report which called old summary plot format * renamed summary_plot to summary_plots to reflect a dict with multiple plots commit 62900e9ae6fa37ce99a04f12a63ed5c912f75042 Author: Cole Lyman <Cole@colelyman.com> Date: Tue May 3 20:47:52 2022 -0600 Large aggregation (#192) * Squashed commit of the following: commit 8564eb03f0d9e62abf4b7528baf5c2ae296be8f9 Merge: f6ef62c 07cc7d8 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Jan 11 16:20:15 2022 -0500 Merge branch 'indel-alignment-fix' of https://github.com/edilytics/CRISPResso2 into indel-alignment-fix commit 07cc7d856ab3fcbbaa5381f17f29568192388887 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:29:59 2021 -0700 Fix bug in `find_indels_substitutions` This bug occurred when there was a deletion at the end of a sequence, and was thus not properly accounted for. commit f6ef62cfdf909adac1b10ea86555cd218f8b2a74 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:29:59 2021 -0700 Fix bug in `find_indels_substitutions` This bug occurred when there was a deletion at the end of a sequence, and was thus not properly accounted for. commit 7212f87f4be60057a6c848947ff6b5efde132a25 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:26:17 2021 -0700 Add a unit test for `find_indels_substitutions` This unit test checks for deletions at the end of a sequence, which are inherently outside of the include_indx_set window. commit d50b4e903b973c71a275e31d470b40e59280ee13 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:03:22 2021 -0700 Fix a bug in `find_indels_substitutions` The bug that this commit fixes is when an insertion occurs at the edge of the include indexes. The trouble with this earlier was that it was using the `idx` to calculate the size of the insertion, but the `idx` wasn't being incremented anymore because it was outside of the include window. commit 4db066f7bc333b7662a9232ac732ebb33ac3ace8 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:01:39 2021 -0700 Add test case for `find_indels_substitutions` This test case is extracted from the CRISPRessoBatch integration test and provides an example where there is an insertion at the edge of the include index. commit 3b3a7417f5bbd6c2785a2af54a47e01d2e820451 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 11:37:07 2021 -0700 Fix bug in CRISPRessoCompare where sample names were not properly set This was a place where it was (partially) missed during the crispresso2_info object refactoring. commit e9f5eff3d95b676b5ee2e23371a5604f600d34b2 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:26:17 2021 -0700 Add a unit test for `find_indels_substitutions` This unit test checks for deletions at the end of a sequence, which are inherently outside of the include_indx_set window. commit d4d45a918254ab19a7e7956e9e731389c6f36ecb Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:03:22 2021 -0700 Fix a bug in `find_indels_substitutions` The bug that this commit fixes is when an insertion occurs at the edge of the include indexes. The trouble with this earlier was that it was using the `idx` to calculate the size of the insertion, but the `idx` wasn't being incremented anymore because it was outside of the include window. commit 13f00bb40239c83e6e5cf844561fdb7000d3d9ab Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:01:39 2021 -0700 Add test case for `find_indels_substitutions` This test case is extracted from the CRISPRessoBatch integration test and provides an example where there is an insertion at the edge of the include index. commit 659ae34e8fd106f7ecc163b5bea0b5a80ab0283c Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 11:37:07 2021 -0700 Fix bug in CRISPRessoCompare where sample names were not properly set This was a place where it was (partially) missed during the crispresso2_info object refactoring. * Add parameter `--suppress_batch_summary_plots` If many runs are run at the same time, batch summary plots may fail because they are too large for matplotlib. This parameter `--suppress_batch_summary_plots` allows individual runs to be plotted, but suppresses batch summary plots that may otherwise be too big. * Pep formatting cleanup * Add summary nucleotide plots to aggregate * Aggregate plots are paginated * Update CRISPRessoAggregateCORE.py Remove max sample limit for plotting * Add --max_samples_per_summary_plot to CRISPRessoAggregate Parameterize the max number of samples to plot on each page of reports. Additional PDFs will be created with this number of samples on them. * Add plotly function to plot an interactive heatmap * Fix deprecated numpy type to suppress warning * Add plotting of heatmaps to CRISPRessoAggregateCORE to summarize modification types These heatmaps are interactive (zoomable and panable) and show for each sample the percentage of insertions, substitutions, and deletions. * Add the heatmap summaries to the CRISPRessoAggregate report * Update Bootstrap to 5.1.3 This is mainly so that we can use the fullscreen modal functionality in this version. * Move the plotly heatmaps to a Bootstrap modal * Fix bug where plots were not filling up entire modal. I have tried countless different ways for this to work, and this is the best that I can come up with. After the modal is opened it triggers the plot to resize, and then for some reason you need to trigger the resize event. I think this is because a `div` changing size won't actually trigger the resizing of the plot (and neither will just calling `Plotly.Plots.resize`...?!). * Update the axis labels and add autosize to plotly heatmaps I'm pretty sure the autosize doesn't do anything, but it is there for good measure. * Abandon attempts to make plots fullscreen This includes removing the Bootstrap modal (two out of the three plots would resize properly and I couldn't figure out a way to have the plot displayed outside of the modal). I have left in some javascript to make the plot fullscreen, but I couldn't get the formatting quite right and the plot wasn't much bigger in the fullscreen version because there was a ton of space between the plot and the heatmap. If some brave soul would like to tackle it, feel free! * Rename and refactor how plot data is passed around I have consolidated how the plot data is passed around, so that now you can pass in only one dict with all of the information instead of 4 or 5 separate parameters. I also renamed the `heatmap_plot_*` to `allele_modification_heatmap_*`. * Implement the line plot version of the modification percentages This also includes correctly resizing the plot when the line plot tab is selected! * Change default `max_samples_per_summary_plot` to be 150 instead of 250 * Remove extra assignments of `this_number_samples` and suppress plot The plot that is suppressed is the large nucleotide quilt when there is a large number of samples. Is it okay to suppress this plot @kclem? * Implement parallel plotting in CRISPRessoAggregate * Fix sample indexing error and heatmap scaling for large number of samples * Add parameter `--suppress_batch_summary_plots` If many runs are run at the same time, batch summary plots may fail because they are too large for matplotlib. This parameter `--suppress_batch_summary_plots` allows individual runs to be plotted, but suppresses batch summary plots that may otherwise be too big. * Pep formatting cleanup * Add summary nucleotide plots to aggregate * Aggregate plots are paginated * Update CRISPRessoAggregateCORE.py Remove max sample limit for plotting * Add --max_samples_per_summary_plot to CRISPRessoAggregate Parameterize the max number of samples to plot on each page of reports. Additional PDFs will be created with this number of samples on them. * Add plotly function to plot an interactive heatmap * Fix deprecated numpy type to suppress warning * Add plotting of heatmaps to CRISPRessoAggregateCORE to summarize modification types These heatmaps are interactive (zoomable and panable) and show for each sample the percentage of insertions, substitutions, and deletions. * Add the heatmap summaries to the CRISPRessoAggregate report * Update Bootstrap to 5.1.3 This is mainly so that we can use the fullscreen modal functionality in this version. * Move the plotly heatmaps to a Bootstrap modal * Fix bug where plots were not filling up entire modal. I have tried countless different ways for this to work, and this is the best that I can come up with. After the modal is opened it triggers the plot to resize, and then for some reason you need to trigger the resize event. I think this is because a `div` changing size won't actually trigger the resizing of the plot (and neither will just calling `Plotly.Plots.resize`...?!). * Update the axis labels and add autosize to plotly heatmaps I'm pretty sure the autosize doesn't do anything, but it is there for good measure. * Abandon attempts to make plots fullscreen This includes removing the Bootstrap modal (two out of the three plots would resize properly and I couldn't figure out a way to have the plot displayed outside of the modal). I have left in some javascript to make the plot fullscreen, but I couldn't get the formatting quite right and the plot wasn't much bigger in the fullscreen version because there was a ton of space between the plot and the heatmap. If some brave soul would like to tackle it, feel free! * Rename and refactor how plot data is passed around I have consolidated how the plot data is passed around, so that now you can pass in only one dict with all of the information instead of 4 or 5 separate parameters. I also renamed the `heatmap_plot_*` to `allele_modification_heatmap_*`. * Implement the line plot version of the modification percentages This also includes correctly resizing the plot when the line plot tab is selected! * Change default `max_samples_per_summary_plot` to be 150 instead of 250 * Remove extra assignments of `this_number_samples` and suppress plot The plot that is suppressed is the large nucleotide quilt when there is a large number of samples. Is it okay to suppress this plot @kclem? * Implement parallel plotting in CRISPRessoAggregate * Fix sample indexing error and heatmap scaling for large number of samples * Add plotly requrement to setup.py * Remove space around vertical barcharts * Add scrollbar to long images in multiReport * Fill in default (empty) values to allele modification plots When not running CRISPRessoAggregate, default values for the `allele_modification_heatmap_plot` and `allele_modification_lin_plot` dictionaries will be set so that the template can be properly rendered. * Include CRISPRessoBatch in the refactor of how summary_plot dicts are handled * Update dockerfile for new docker * minor bug fixes for plotCustomAllelePlot.py to work with Python3 (#212) * Allow for flexible parsing of quant window coordinates * CRISPRessoPooled debug flash command, fix pep formatting * Set flexiguide homology parameter type to int * Coerce ints in batch file checking (#200) * Batch type coerce and r2 file check * Revert "Batch type coerce and r2 file check" This reverts commit f91736688ea9739cf3063e3601c52ad6da1116a4. * Coerce int values * Handle multiple qwcs in batch mode If multiple qwcs were provided in batch mode, a parsing error would occur. This fixes this bug. * Fix bug from old pandas for int cols Evidently old pandas versions throw an error if a column doesn't exist. This checks to see if the column exists before the values are set. * Create allele modification heatmaps and line plots in CRISPRessoBatch * Add allele modification heatmaps and line plots to CRISPRessoBatch * Make all plots in CRISPRessoBatch run in parallel * Make `--suppress_batch_summary_plots` store true Also, only open and shutdown the process pool when necessary. * Add blank values for allele_modification entries when not present Co-authored-by: Kendell Clement <k.clement.dev@gmail.com> Co-authored-by: dharjanto <dewi.harjanto@gmail.com> Co-authored-by: Samuel Nichols <Snic9004@gmail.com> commit f67376fc9ab0e407d4086aa42fd1c77706ebc9c0 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Fri Apr 15 00:46:30 2022 -0400 Fix bug from old pandas for int cols Evidently old pandas versions throw an error if a column doesn't exist. This checks to see if the column exists before the values are set. commit b34fe2956ff88629809b2434878028723dfc4895 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Apr 14 23:58:07 2022 -0400 Handle multiple qwcs in batch mode If multiple qwcs were provided in batch mode, a parsing error would occur. This fixes this bug. commit c94e3b9f2e301bda91e9c1e6f4ef794b33b5dbf0 Author: Samuel Nichols <Snic9004@gmail.com> Date: Thu Apr 14 21:48:32 2022 -0600 Coerce ints in batch file checking (#200) * Batch type coerce and r2 file check * Revert "Batch type coerce and r2 file check" This reverts commit f91736688ea9739cf3063e3601c52ad6da1116a4. * Coerce int values commit fc4542491bb86eb143db0044a848a56234403496 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Apr 14 22:13:23 2022 -0400 Set flexiguide homology parameter type to int commit 23fe2aa8e26067d1bcf36bfafc67e023c7588d2f Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Apr 14 22:12:37 2022 -0400 CRISPRessoPooled debug flash command, fix pep formatting commit d292d33d8c1fa3bfd2cee656643fd47bcdab161d Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Apr 14 22:00:19 2022 -0400 Allow for flexible parsing of quant window coordinates commit e1667cb53a7ea6fbb33369c8530a78639ed423ec Author: dharjanto <dewi.harjanto@gmail.com> Date: Mon Apr 11 22:08:21 2022 -0400 minor bug fixes for plotCustomAllelePlot.py to work with Python3 (#212) commit 7b8f6788da18f6ab173fa3c3d10f4ab6bb2acc26 Author: Samuel Nichols <Snic9004@gmail.com> Date: Fri Apr 8 10:21:00 2022 -0600 Update README commit 9bc24cd0474ed9f398dff64274d3181c4b2f8637 Author: Samuel Nichols <Snic9004@gmail.com> Date: Tue Mar 29 11:25:09 2022 -0600 Using Amplicon_Name commit 88ac5d72074b3da63de035e02c911ce34cd29414 Merge: b6057a2d e5afa478 Author: Samuel Nichols <Snic9004@gmail.com> Date: Mon Mar 28 22:32:09 2022 -0600 Merge remote-tracking branch 'origin/master' into 2-flexible-pooled-input commit b6057a2d54cb8637ff0900416de8e2de72213f76 Author: Samuel Nichols <Snic9004@gmail.com> Date: Mon Mar 28 20:53:05 2022 -0600 Printing info statements for matched headers commit af4ab6e8507d7aa4b7b68f217a458e0d9c966f55 Merge: bbb7d6f0 51a943c3 Author: Cole Lyman <Cole@colelyman.com> Date: Fri Mar 25 09:44:13 2022 -0600 Merge branch 'pinellolab:master' into master commit 3c1eb012fc02563e3e963f17a62c7e932f5bcddc Author: Samuel Nichols <Snic9004@gmail.com> Date: Thu Mar 24 12:31:43 2022 -0600 Debugging and column checking commit 0b47acbc592a6df6adf14641357b2104b76be691 Author: Samuel Nichols <Snic9004@gmail.com> Date: Wed Mar 23 09:42:51 2022 -0600 New variables added to pooled commit a0ff3a44d6d19d7b37f91919b5c0180206f72d53 Author: Samuel Nichols <Snic9004@gmail.com> Date: Mon Mar 21 09:32:28 2022 -0600 Read as string not bytes commit 710675fc3c0307e21103abd604315b47ff80a894 Author: Samuel Nichols <Snic9004@gmail.com> Date: Wed Mar 16 13:51:30 2022 -0600 Adding command building for new options commit f386818a48e5c840bd567611e6f1320c8146cac7 Author: Samuel Nichols <Snic9004@gmail.com> Date: Wed Mar 16 10:08:33 2022 -0600 Comment out df_template.iloc instance commit eb5e309da57c8b96cd760728ddbf67be05f30d1c Author: Samuel Nichols <Snic9004@gmail.com> Date: Wed Mar 16 09:59:19 2022 -0600 Potential solution for flexible headers commit 51a943c3a8f8181963acc420e75a5e8ee103cf7c Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Mar 15 11:00:46 2022 -0400 CRISPRessoPooled pep formatting and fix CRISPRessoPooled doesn't re-count reads if it has been run once and the `aligned_pooled_bam` is provided as input pep code formatting changes commit bbb7d6f0907aa13518d20e7f470e7de518b825f4 Merge: ddbd39f0 5a10d638 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Mar 15 10:23:38 2022 -0400 Merge branch 'master' of https://github.com/edilytics/CRISPResso2 commit 5a10d638c638f21f8a2934955e92ef7e117b889e Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sat Feb 26 14:21:57 2022 -0500 Move metadata for bam input and output commit e5afa4784d5330a1dc95c5deafcd9217edeac631 Author: Samuel Nichols <Snic9004@gmail.com> Date: Wed Feb 16 10:20:24 2022 -0700 Coerce int values commit ede7d85b50055311908000578c76a1860ae9de4d Author: Samuel Nichols <Snic9004@gmail.com> Date: Wed Feb 16 10:18:29 2022 -0700 Revert "Batch type coerce and r2 file check" This reverts commit f91736688ea9739cf3063e3601c52ad6da1116a4. commit f91736688ea9739cf3063e3601c52ad6da1116a4 Author: Samuel Nichols <Snic9004@gmail.com> Date: Wed Feb 16 10:10:52 2022 -0700 Batch type coerce and r2 file check commit 7b4a310b0f8b64c00e02eca3d522ad50d39b43ae Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Feb 15 22:18:05 2022 -0500 Reiterate WGS region file is tab-separated Add note to WGS description that region file should be tab-separated. Closes #199 commit b8497542e388ad401d0815d426f27abc3201a76d Author: kclem <k.clement.dev@gmail.com> Date: Fri Feb 11 15:07:14 2022 -0500 Extend x-axis to longest scaffold incorporation length commit ab7248947afade089809c74bfe6e9d5394e8f6dc Author: kclem <k.clement.dev@gmail.com> Date: Wed Feb 9 17:05:11 2022 -0500 Fix prime editing indexing for plots commit ddbd39f06b262d5ebd2cc69e116c08b22b6bd84e Merge: a7ffd468 442a48c7 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jan 13 15:35:36 2022 -0500 Merge branch 'pinellolab:master' into master commit 442a48c7f4c62ec2ebc95fe268475e5e2a4b2f0c Author: Cole Lyman <Cole@colelyman.com> Date: Tue Jan 11 15:28:28 2022 -0700 Indel alignment fix (#182) * Fix bug in CRISPRessoCompare where sample names were not properly set This was a place where it was (partially) missed during the crispresso2_info object refactoring. * Add test case for `find_indels_substitutions` This test case is extracted from the CRISPRessoBatch integration test and provides an example where there is an insertion at the edge of the include index. * Fix a bug in `find_indels_substitutions` The bug that this commit fixes is when an insertion occurs at the edge of the include indexes. The trouble with this earlier was that it was using the `idx` to calculate the size of the insertion, but the `idx` wasn't being incremented anymore because it was outside of the include window. * Add a unit test for `find_indels_substitutions` This unit test checks for deletions at the end of a sequence, which are inherently outside of the include_indx_set window. * Fix bug in CRISPRessoCompare where sample names were not properly set This was a place where it was (partially) missed during the crispresso2_info object refactoring. * Add test case for `find_indels_substitutions` This test case is extracted from the CRISPRessoBatch integration test and provides an example where there is an insertion at the edge of the include index. * Fix a bug in `find_indels_substitutions` The bug that this commit fixes is when an insertion occurs at the edge of the include indexes. The trouble with this earlier was that it was using the `idx` to calculate the size of the insertion, but the `idx` wasn't being incremented anymore because it was outside of the include window. * Add a unit test for `find_indels_substitutions` This unit test checks for deletions at the end of a sequence, which are inherently outside of the include_indx_set window. * Fix bug in `find_indels_substitutions` This bug occurred when there was a deletion at the end of a sequence, and was thus not properly accounted for. * Fix bug in `find_indels_substitutions` This bug occurred when there was a deletion at the end of a sequence, and was thus not properly accounted for. * Squashed commit of the following: commit 8564eb03f0d9e62abf4b7528baf5c2ae296be8f9 Merge: f6ef62c 07cc7d8 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Jan 11 16:20:15 2022 -0500 Merge branch 'indel-alignment-fix' of https://github.com/edilytics/CRISPResso2 into indel-alignment-fix commit 07cc7d856ab3fcbbaa5381f17f29568192388887 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:29:59 2021 -0700 Fix bug in `find_indels_substitutions` This bug occurred when there was a deletion at the end of a sequence, and was thus not properly accounted for. commit f6ef62cfdf909adac1b10ea86555cd218f8b2a74 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:29:59 2021 -0700 Fix bug in `find_indels_substitutions` This bug occurred when there was a deletion at the end of a sequence, and was thus not properly accounted for. commit 7212f87f4be60057a6c848947ff6b5efde132a25 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:26:17 2021 -0700 Add a unit test for `find_indels_substitutions` This unit test checks for deletions at the end of a sequence, which are inherently outside of the include_indx_set window. commit d50b4e903b973c71a275e31d470b40e59280ee13 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:03:22 2021 -0700 Fix a bug in `find_indels_substitutions` The bug that this commit fixes is when an insertion occurs at the edge of the include indexes. The trouble with this earlier was that it was using the `idx` to calculate the size of the insertion, but the `idx` wasn't being incremented anymore because it was outside of the include window. commit 4db066f7bc333b7662a9232ac732ebb33ac3ace8 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:01:39 2021 -0700 Add test case for `find_indels_substitutions` This test case is extracted from the CRISPRessoBatch integration test and provides an example where there is an insertion at the edge of the include index. commit 3b3a7417f5bbd6c2785a2af54a47e01d2e820451 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 11:37:07 2021 -0700 Fix bug in CRISPRessoCompare where sample names were not properly set This was a place where it was (partially) missed during the crispresso2_info object refactoring. commit e9f5eff3d95b676b5ee2e23371a5604f600d34b2 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:26:17 2021 -0700 Add a unit test for `find_indels_substitutions` This unit test checks for deletions at the end of a sequence, which are inherently outside of the include_indx_set window. commit d4d45a918254ab19a7e7956e9e731389c6f36ecb Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:03:22 2021 -0700 Fix a bug in `find_indels_substitutions` The bug that this commit fixes is when an insertion occurs at the edge of the include indexes. The trouble with this earlier was that it was using the `idx` to calculate the size of the insertion, but the `idx` wasn't being incremented anymore because it was outside of the include window. commit 13f00bb40239c83e6e5cf844561fdb7000d3d9ab Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:01:39 2021 -0700 Add test case for `find_indels_substitutions` This test case is extracted from the CRISPRessoBatch integration test and provides an example where there is an insertion at the edge of the include index. commit 659ae34e8fd106f7ecc163b5bea0b5a80ab0283c Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 11:37:07 2021 -0700 Fix bug in CRISPRessoCompare where sample names were not properly set This was a place where it was (partially) missed during the crispresso2_info object refactoring. * Fix bug in `find_indels_substitutions` This bug occurred when there was a deletion at the end of a sequence, and was thus not properly accounted for. Co-authored-by: Kendell Clement <k.clement…
Snicker7
added a commit
to edilytics/CRISPResso2
that referenced
this pull request
Apr 4, 2024
commit 603f2eff9d1aa21ae95f3e134da303b8018d3a33 Author: Samuel Nichols <Snic9004@gmail.com> Date: Fri Jan 12 09:48:20 2024 -0700 fix guardrials partial commit 22fc03183a8070c30dfb74d5c23575ac19019855 Author: Samuel Nichols <Snic9004@gmail.com> Date: Fri Jan 12 08:54:01 2024 -0700 Add guardrail partial commit e55f6b21972b578261bc5a864ce1d653d98f9e34 Author: Samuel Nichols <Snic9004@gmail.com> Date: Mon Jan 8 07:50:59 2024 -0700 Functional guardrails, needs reports update commit 6e968e9699ed59a47d88191d03768e042d8b60a4 Merge: 32b49685 e948ce10 Author: Samuel Nichols <Snic9004@gmail.com> Date: Mon Dec 18 13:34:36 2023 -0700 Merge branch 'guardrails-clean-history' of https://github.com/edilytics/CRISPResso2 into guardrails-clean-history commit 32b49685da320501dad2b0ebbb57887b66220ba8 Author: Samuel Nichols <Snic9004@gmail.com> Date: Fri Dec 15 15:27:04 2023 -0700 Include guardrail functions commit 4e309cf6f732565d635de3d4c5d074ada3027e2d Author: Cole Lyman <cole@colelyman.com> Date: Mon Dec 18 10:51:55 2023 -0700 Refactor to use CRISPRessoReports module commit e648dc087c0055bc5d2fca13c64071a371dea941 Author: Cole Lyman <cole@colelyman.com> Date: Mon Dec 18 10:51:11 2023 -0700 Add CRISPRessoReports subtree commit e948ce107ebb0d1d99010ed12e937f34b5e607d4 Author: Samuel Nichols <Snic9004@gmail.com> Date: Fri Dec 15 15:27:04 2023 -0700 Include guardrail functions commit d33c748871a625facfe8d792e29c77ab9779138f Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Nov 7 16:31:06 2023 -0700 Include parameter --assign_ambiguous_alignments_to_first_reference in readme commit a1435f7f491a6a61434f3051e39f39a4c9bf1edc Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed Oct 11 17:17:30 2023 -0600 Enable quantification by sgRNA (#348) This PR includes: - storing the sgRNA-specific editing locations in the crispresso2_info object. Previously, each amplicon would record the indices of quantification windows across the guide, but not for individual guides. This stores the information for each guide in crispresso2_info['results']['refs'][reference_name]['sgRNA_include_idxs'] - a script (count_sgRNA_specific_edits.py) to parse through an allele table output from a completed CRISPResso run (`--write_detailed_allele_table` flag required) to count edits in each sgRNA separately. I don't have a good double-edited sample handy, but it can be run on the demo HDR data [hdr.fastq.gz](http://crispresso.pinellolab.org/static/demo/hdr.fastq.gz) using the command: ``` CRISPResso -r1 hdr.fastq.gz -a acatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgTggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttggtatcaaggtta -e acatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcaCctgactccGgaggagaagtctgccgttactgcGctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttggtatcaaggtta -c atggtgcatctgactcctgTggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcag -g TGCACCATGGTGTCTGTTTG,GATGAAGTTGGTGGTGAGGCCC --write_detailed_allele_table -n hdr3 -p max -gn guide1,guide2 ``` ``` python CRISPResso2/scripts/count_sgRNA_specific_edits.py -f CRISPResso_on_hdr3 ``` This produces: ``` Processed 25000 alleles Reference: Reference (2391/23415 modified reads) UNMODIFIED: 21024 MODIFIED guide1: 2359 MODIFIED guide2: 32 Reference: HDR (856/1577 modified reads) UNMODIFIED: 721 MODIFIED guide1: 854 MODIFIED guide1 + guide2: 1 MODIFIED guide2: 1 ``` commit 2e3da02fdbed2fa8ae02a277763d65a502459827 Author: Cole Lyman <Cole@colelyman.com> Date: Tue Oct 10 15:29:08 2023 -0600 changed tuple to list for matplotlib change (#31) (#346) Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com> commit cd3c332135fe4db0f9218e3d87263d5c65838ed9 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sun Oct 1 01:54:46 2023 -0600 rename script to camel case commit 7c719d65fb36ac7654db9040f226564ea28fcab9 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sun Oct 1 01:53:44 2023 -0600 Add new script for counting high quality bases commit f97cd2795e89464bcc9321ccfdbca3e6af2bcb4f Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Sep 14 15:15:30 2023 -0600 Prime editing alignment params (#336) Adds two parameters to control alignment of pegRNA components: --prime_editing_gap_open_penalty and --prime_editing_gap_extend_penalty. CRISPResso checks to see whether the pegRNA spacer and extension sequence are in the correct orientation, but sometimes they could align in the incorrect orientation with a higher score (e.g. via insertion of multiple gaps, whereas a single long gap would be preferred). Introducing these two parameters allows users to adjust the alignment parameters specifically for these prime-editing checks without adjusting the global alignment parameters which will be applied to reads that are aligned to the WT reference/prime-editing reference sequences. The new prime_editing_gap_open_penalty is set to -50, a higher gap open penalty than the default needleman_wunsch_gap_open penalty (-20). This commit breaks backward-reproducibility, but mostly in the checking of pegRNA component orientation - so previously some CRISPResso runs would have failed and produced an error, but now they will (hopefully) succeed. To achieve complete backward reproducibility, add the flag --prime_editing_gap_open_penalty -20 to runs. commit 64cbf36dae85cffa2c15e73f2a7ee8aa1077d917 Author: Cole Lyman <Cole@colelyman.com> Date: Thu Sep 7 16:43:30 2023 -0600 Fix samtools piping (#325) * Remove samtools pipe stderr to stdout Sometimes some of the libraries that samtools depends on don't have the correct version information, and as such samtools will report this to stderr when run. Because we pipe the output of samtools, we expect it to be valid SAM format, but when these library version messages are reported, it breaks CRISPRessoWGS. * Remove extra spacing at end of lines and add missing comma in WGS * Log stderr from samtools in CRISPRessoWGS commit 8feff4101f27406d9d88ace97d31a518276bff3f Author: Cole Lyman <Cole@colelyman.com> Date: Fri Sep 1 09:43:56 2023 -0600 Replace link to CRISPResso schematic with raw URL in README (#329) * Replace link to CRISPResso schematic with raw URL * Add new lines to the beginning of unordered lists commit 2e9e6bff5bcc536d5e2ba1440d1ab96d9d47efd6 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Aug 10 00:52:12 2023 -0600 Try to unbreak CircleCI commit ae5b95246cb0f6d66c4cbfb50cf8f5a9626b0827 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Aug 10 00:17:27 2023 -0600 Center command line text messages commit 4d9c71ecf2248c9bb1e10430178dc318b6621c8b Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Aug 10 00:17:07 2023 -0600 Fix bug in prime-editing scaffold-incorporation plotting If read is too short, scaffold incorporation detection will fail because it will check beyond the length of the read. commit 2b36a1a5c35e8a93516ce8baf464595615e0f402 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed Aug 9 15:29:48 2023 -0600 CRISPRessoPooled --compile_postrun_references bug fixes commit 3e04d1d402bcf95edd39fc7c8c9af61bb380f9db Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Aug 8 23:30:15 2023 -0600 Fix missing ' in Pooled --demultiplex_only_at_amplicons commit 06af527f9e2020c5cf251e7f1cec0b1eca1c1664 Author: Cole Lyman <Cole@colelyman.com> Date: Mon Jul 24 10:47:46 2023 -0600 Sort pandas dataframes by # of reads and sequences so that the order is consistent (#316) * Make sorting stable * Including c files * Sort by #Reads instead of %Reads to avoid floating point errors --------- Co-authored-by: Samuel Nichols <Snic9004@gmail.com> commit de05533b3511a84f3b6b14fc2ef64db041613261 Author: Cole Lyman <Cole@colelyman.com> Date: Thu Jul 6 13:54:45 2023 -0600 Fix multiprocessing lambda pickling (#311) * Fix running plots in parallel The reason the plots were running slower before this change is because I was calling the plot function, not passing it to `submit`. So it was essentially running in serial, but worse because it was still spinning up/down the processes. * Fix multiprocessing lambda pickling (#20) * Refactor process_futures to be a dict This makes debugging much easier because you can associate the arguments to the future with the results. * Fix the pickling error when running in multiprocessing Only top-level functions (not lambdas) can be pickled to use in multiprocessing pools, thus the lambdas are converted to a regular function. * Further fixes to pickling multiprocessing error (#21) * Refactor process_futures to be a dict This makes debugging much easier because you can associate the arguments to the future with the results. * Fix the pickling error when running in multiprocessing Only top-level functions (not lambdas) can be pickled to use in multiprocessing pools, thus the lambdas are converted to a regular function. * Use Counter instead of defaultdict in CRISPRessoCORE * Update process_futures to dict in Batch and Aggregate commit ebb016dff46c280dce8c3c09e8ac0e0cc25d4d74 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Jul 3 17:12:09 2023 -0600 Enable CRISPRessoPooled multiprocessing when os allows multi-thread file append commit 7285da0e987b77b72c8885bb35940e0f50c146bd Author: Kendell Clement <k.clement.dev@gmail.com> Date: Fri Jun 23 16:50:33 2023 -0600 Fix print bug for invalid fastq commit 9acdeac67441f9a1d55ac94b153bcb68fb89b92c Author: kclem <k.clement.dev@gmail.com> Date: Wed Jun 21 16:03:48 2023 -0600 Slugify before creating filename - replaces invalid characters in batch names with _ commit f97e29c67de4c80b8d6b9cf334f363be4b514ade Author: Cole Lyman <Cole@colelyman.com> Date: Wed Jun 21 14:43:43 2023 -0600 Add verbosity argument to CRISPRessoAggregate (#18) fixes #306 (#307) * Add verbosity argument to CRISPRessoAggregate (#18) * Allow for amplicon and guide seqs to be some variant of NA in batch (#19) This was discovered when attempting to infer amplicon sequences in batch mode on the web interface, NAs were supplied for the amplicon sequences to the sub CRISPResso commands. commit 32e1e9797da5c3033cdc588e92f06b8813961953 Author: Mark Clement <u0351481@notchpeak30.int.chpc.utah.edu> Date: Wed Jun 21 14:01:00 2023 -0600 Allow for interrogation of overlapping sgRNA sites commit 7248ba8c4deee125ad1ec12fdf1294a84d5f6f93 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Jun 12 12:16:47 2023 -0600 Check input fastq file format Asserts input format of fastq files - including if gzipped files are missing the gz suffix. commit 83c8ab8f462e7d8c1d04c08c1a398b874f517251 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Jun 5 13:41:55 2023 -0600 Fix CRISPRessoArgParser commit 14a2c8577f566e1b72d5f4e72cd6cd22079610be Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Jun 5 13:29:31 2023 -0600 Cosmetic updates for command-line use - version bump to 2.2.13 - If no args are provided, the command line version will print out an abbreviated help message - parameters can be excluded from CRISPRessoArgParser commit 1cd54bc1d03360c3d8121ba9e66b3589fe1cf252 Author: Cole Lyman <Cole@colelyman.com> Date: Thu May 11 14:31:47 2023 -0600 Fix multiprocessing error, don't start pool when only using single thread (#302) * Update README to have consistent use of `--base_editor_output` (#16) * Add files via upload * Only start process pools when using multiple processes This is mainly to solve the issue when running on AWS Lambda, but this should improve single core performance overall. --------- Co-authored-by: Kendell Clement <k.clement.dev@gmail.com> commit 92a705c939b370373a70cf6ae9f1616de33288b9 Author: Cole Lyman <Cole@colelyman.com> Date: Thu May 11 14:31:06 2023 -0600 Update `base_editor` parameters in README and add Plot Harness (#301) * Update README to have consistent use of `--base_editor_output` (#16) * Add files via upload --------- Co-authored-by: Kendell Clement <k.clement.dev@gmail.com> commit 7d46c4490235df45c5546b1b470e4e6a99727031 Author: Cole Lyman <Cole@colelyman.com> Date: Wed May 10 15:41:33 2023 -0600 Clarify CRISPRessoWGS intended use (#303) * Update README to have consistent use of `--base_editor_output` (#16) * Add sample plotting jupyter notebook * Add clarifying info to CRISPRessoWGS description Clarify WGS usage commit 833a701787bb47674b3e921c38cac6189c775cf7 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu May 4 17:02:46 2023 -0400 Remove debug print statements commit 712eb2a11825e8d36f2870deb12b35486bd633fb Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu May 4 16:40:07 2023 -0400 Allow dashes in filenames resolve #73 commit a439f094745b2b5e7f032f0777d4c67e6d6f93c5 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sat Apr 22 23:41:58 2023 -0400 Raise exceptions from within futures in plot_pool commit 7e807a60de2a9d18bccd034b87106ceaf7153338 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sat Apr 22 23:38:56 2023 -0400 Fix future pandas indexing warning Pandas error was "FutureWarning: Calling float on a single element Series is deprecated and will raise a TypeError in the future. Use float(ser.iloc[0]) instead" commit 304a92aa7a7ef8c705cb070dce25d9a2e5745ba9 Author: Cole Lyman <Cole@colelyman.com> Date: Thu Apr 20 13:59:27 2023 -0600 Remove debug print statements fixes #295 (#297) The format string option used here is only available in Python version >=3.8. commit 478c06f784603e96d20f96e91993fdcc4ac35c8a Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Apr 13 12:09:26 2023 -0400 Update plotCustomAllelePlot.py script for #292 (#293) Update type of 'max_rows' param to int Fix location of 'args' in crispresso2_info object commit bcdae39e05d530f4a4e78738c3b30f7664981919 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Mar 27 13:18:34 2023 -0400 Update pooled parameter format commit 546446e36e7e68b527767d6c31ec341a49df2059 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Feb 14 16:26:23 2023 -0500 Fix running plots in parallel (#286) The reason the plots were running slower before this change is because I was calling the plot function, not passing it to `submit`. So it was essentially running in serial, but worse because it was still spinning up/down the processes. Co-authored-by: Cole Lyman <cole@colelyman.com> commit d75f32a2eb5aeaaee866c09e5655a3e27af8b1a1 Author: kclem <k.clement.dev@gmail.com> Date: Fri Feb 10 15:45:15 2023 -0500 Fix #283 to avoid filename collisions Previously, amplicon names longer than 21bp were truncated, but the check for uniqueness wasn't working, so it would overwrite some plot files. This fixes the filename collision and enforces uniqueness in reference filename prefixes. Thanks @mbiokyle29 commit e577318006cd17b2725bd028e5e56634c6eb829a Author: kclem <k.clement.dev@gmail.com> Date: Mon Feb 6 16:37:25 2023 -0500 Case-insensitive headers accepted in CRISPRessoPooled commit d34927620a4a6126a9988b3041e76f60728abbfe Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Jan 31 13:48:33 2023 -0500 Fix print statement in CORE commit ee88b7ed89c395f68225a50dea44a2ad69d5e9a5 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Jan 31 13:22:51 2023 -0500 Version bump to 2.2.12 commit 1d4679c72d0c8b4154317c9aff5179217198e2d7 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Jan 31 13:01:31 2023 -0500 Status Updates + Pooled Mixed Mode Update (#279) * Implement logging handler to overwrite the latest log status to file * Add StatusHandler to CRISPRessoCORE log This will take the latest log output and write it to a file (`status.txt`), the catch being that with each log the file is overwritten so that one can easily tell where CRISPResso currently is and what the error is (if any). These changes include some slight refactoring in order to accomodate any potential parameter exceptions. * Add StatusHandler to CRISPRessoBatch and refactor `logger.warn` to `warn` * Add StatusHandler to CRISPRessoPooled and a little refactoring * Implement `percent_complete` to the status log * Add StatusHandler to CRISPRessoAggregate log * Add StatusHandler to CRISPRessoCompare log * Add StatusHandler to CRISPRessoPooledWGSCompare log * Add StatusHandler to CRISPRessoWGS log * Rename `status.txt` to `CRISPResso_status.txt` * Modify status log names to match the tool they are generated from * Add percent_complete stages to CRISPRessoCORE These also include log statements of each plot that is being generated as well as fixing some variable name collisions with `ind`. * Format the percentage in the log to be 2 decimal places * Change all plotting logs from `info` to `debug` and simplify progress This refactors how the progress of the plots is calculated, making it much simplier. Before this change we would of had to keep track of the number of times `percent_complete` was output, but now it simply updates the percent complete after each amplicon is finished processing. Hopefully this will make things easier to mantain even though it will be a little less "accurate" (not sure how accurate the original implementation was...). * Implemented shared console log handler across all CRISPResso* calls This allows for easy changes to logging formatting, which was inspired by having to change the default logging level. The default logging level needs to be set at `logging.DEBUG` in order for the debug log statements to not be ignored for the running and status logs. * Add ability to set the verbosity level to each CRISPResso* tool This allows users to set a verbosity level between 1 and 4 using the `-v`/`--verbosity` CLI parameter. If the `--debug` flag is present, then the level will default to 4, being the most verbose. * Implement showing the last seen `percent_compelte` when none is provided * Keep track of and log when multiple parallel runs are completed These changes modify `CRISPRessoMultiProcessing.run_crispresso_cmds` such that we can now display when a run is completed. This potentially breaks how signals and interupts are handled with multiple runs happening, but this needs to be reviewed. * Add debug and percentage complete to CRISPRessoBatch * Add percent complete to CRISPRessoPooled * Add debug and percent_complete message to CRISPRessoAggregate * Add `percent_complete` to CRISPRessoCompare * Add `percent_complete` to CRISPRessoPooledWGSCompare * Add status and `percent_complete` to CRISPRessoMeta * Add `verbosity` arguments to CRISPRessoCompare and CRISPRessoPooledWGSCompare * Fixing documentation to match pooled headers * Header removal bug fix change documentation to guide_seq * Update documentation and help feature for CRISPRessoPooled * Remove extra newlines from CRISPRessoPooled -h * Make variable names as clear as my firstborn child's name * Update one more variable name * Fix bug to flow CRISPRessoPooled options to sub command * Make amplicon file args variable name clear * Update how parameters are set and retrieved from parameter object The refactor in the previous commit changed the type of the arguments to a dictionary which doesn't have the parameters as attributes, and this commit fixes that error. * Add note in output header for change in default CRISPRessoPooled In the next release (2.3.0) the `--demultiplex_only_at_amplicons` will be the default when running in mixed-mode. This is to allow for inexact alignments of the reads and the amplicons to the genome. For more context, see this issue https://github.com/pinellolab/CRISPResso2/issues/276 * Clarify the verbosity parameter help message * Separate out parameters to `normalize_name` in CRISPRessoCORE * Separate out parameters to `normalize_name` in CRISPRessoWGS * Separate out parameters to `normalize_name` in CRISPRessoPooled * Separate out parameters to `normalize_name` in CRISPRessoCompare * Fix bug in CRISPRessoPooled by replacing `database_id` with `normalize_name` * Refactor `run_crispresso_cmds` to not require a `logger` This commit implements the functionality to make the `logger` object optional by seeing which module called the `run_crispresso_cmds` function and obtaining the correct object from that module name. The function also immediately returns when no commands are passed to it. * Add amplicon name to plotting debug statements in CRISPRessoCORE --------- Co-authored-by: Cole Lyman <cole@coles-mbp-2.lan> Co-authored-by: Cole Lyman <cole@Coles-MacBook-Pro-2.local> Co-authored-by: Cole Lyman <cole@colelyman.com> Co-authored-by: Samuel Nichols <Snic9004@gmail.com> commit ff7eca76e6a3a08af4ac18ac4e88d20f2a06b1f9 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jan 26 15:27:27 2023 -0500 CRISPRessoPooled custom header fix (#278) * Fixing documentation to match pooled headers * Header removal bug fix change documentation to guide_seq * Update documentation and help feature for CRISPRessoPooled * Remove extra newlines from CRISPRessoPooled -h * Make variable names as clear as my firstborn child's name * Update one more variable name Co-authored-by: Samuel Nichols <Snic9004@gmail.com> commit 104866e1080c973bb025d1a5ba59b19dca1658af Author: Cole Lyman <Cole@colelyman.com> Date: Thu Jan 5 14:00:26 2023 -0700 Fix deprecated numpy type names (fixes #269) (#270) In the most recent version of numpy (1.24) some of the types have been deprecated. This commit fixes these errors. commit 58a8e42df88b66fad6b4f6ad04a5b9d9d43d01b4 Author: Cole Lyman <Cole@colelyman.com> Date: Thu Jan 5 06:49:35 2023 -0700 Add snippet about installing CRISPResso2 via bioconda on Apple silicon (#274) I have suffered enough trying to debug my installation, so hopefully this helps someone else. Co-authored-by: Cole Lyman <cole@coles-mbp-2.lan> commit b9851e98104602eb78c2b384105267624295e9d3 Author: Cole Lyman <Cole@colelyman.com> Date: Thu Dec 22 13:30:23 2022 -0700 Fix bug when pooled bam is input (#265) This change checks to see if a bam file was input, and if so it doesn't try to remove any intermediate files because there aren't any. Co-authored-by: Cole Lyman <cole@coles-mbp-2.lan> commit b822612642043e75a19042941f69b457ce51f517 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Dec 19 15:26:45 2022 -0500 Delete vscode settings commit b99aa624dec68ef7d19264340ce0cafa829625f4 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Dec 19 13:29:14 2022 -0500 Clarify input param help for pooled bam commit 3fae1e8b821ec6b1890bff6561fa8fa67dc49a04 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Dec 19 13:28:54 2022 -0500 Fix #235 - Cigar string is * if read unaligned Previously, the bam would set the cigar string to 0 if the read was unaligned. This breaks the sam->bam conversion and causes the errors in #235. commit c65ba07dc5a983453cdf7bb1e27005230dac6f1b Author: Cole Lyman <Cole@colelyman.com> Date: Thu Dec 8 13:48:17 2022 -0700 Add deprecation notice (#260) * Add FLASh and Trimmomatic deprecation notice to CLI output * Add Edilytics email address to CLI output commit 2a30e5a45f5350ee7c6435bce1cd4edc4d31668a Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Dec 6 12:16:19 2022 -0500 Format filterReadsOnSequencePresence script commit 9d764414edd88a46ad5e4f496e4f1c8d5d60ce3e Author: Kendell Clement <k.clement.dev@gmail.com> Date: Fri Dec 2 22:12:54 2022 -0500 Clarify default CRISPRessoPooled settings for use_legacy_bowtie2_options_string commit 9ddea40f7f02b546941ddaa4c71fc5283075051a Author: kclem <k.clement.dev@gmail.com> Date: Mon Nov 14 10:33:04 2022 -0500 Add check for prime editing extension sequence in prime edited sequence if the user specifies the prime_editing_override_prime_edited_ref_seq, it could not contain the extension seq (if they don't provide the extension seq in the appropriate orientation), so check that here. Extension sequence should be provided reverse-complement to the prime edited sequence. commit 152f2dd5001da7090641ee8a1326bde9f7e8104e Author: kclem <k.clement.dev@gmail.com> Date: Wed Nov 9 11:53:41 2022 -0500 Version bump to 2.2.11a commit 9ed356e3a0c6c316d0860d121772f80ddca6de1d Author: kclem <k.clement.dev@gmail.com> Date: Wed Nov 9 11:47:30 2022 -0500 Add param to override prime editing sequence checks CRISPResso checks that prime editing guides are provided in the proper orientation (e.g. pegRNA 3'->5', spacer sequence 5'->3') and checks these orientations by alignment. Sometimes, the alignment can be better in the opposite direction, and this parameter allows these checks to be overridden. Otherwise, these checks would halt the program and produce the output 'The prime editing pegRNA spacer sequence appears to be given in the 3\'->5\' order. The prime editing pegRNA spacer sequence (--prime_editing_pegRNA_spacer_seq) must be given in the RNA 5\'->3\' order.' commit 39dd80afb98a22b7edb6f801c363d86bb77eeb5b Author: kclem <k.clement.dev@gmail.com> Date: Wed Nov 9 10:06:51 2022 -0500 Update filterReadsOnSequencePresence.py commit fe55526927e3fb6e17c9a8a6f59c7057bc1e14eb Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Nov 7 22:25:16 2022 -0500 Add script to filter input based on sequence presence commit 713e57a19c35180035ca35e11a5820065eda0198 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Oct 18 16:02:26 2022 -0400 Allow spaces in read names for CRISPRessoWGS commit 39ce008bdddccdd8229c0ba185dce78bc2f66968 Author: Cole Lyman <Cole@colelyman.com> Date: Sat Oct 8 21:09:58 2022 -0600 Fix typo of CRISPResssoPlot when plotting nucleotide quilt (#250) commit 6a2b342c8503b7327c0a2414edfbd16912d60ca5 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sat Oct 8 23:08:47 2022 -0400 Batch amplicon plots (#251) * Error out if HDR amplicon matches existing amplicon * Add check for amplicon sequence uniqueness * Fix bug with bam_input not having bam_output * Test for no returned lines in auto mode, version bump to 2.2.11 * Fix pandas deprecation of df.append commit 726b2b93d6e419a1b0aa6a968c97edc55b4cc5a8 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Oct 6 16:32:02 2022 -0400 Fix CRISPRessoBatch plot pool bug when plots are suppressed commit 7e5049c4dfb88cbc87c91935a91d1f51120a10c2 Author: Cole Lyman <Cole@colelyman.com> Date: Wed Sep 21 21:04:51 2022 -0600 Fix batch quilt plot name (#249) This fixes an incorrectly named allele quilt plot input in CRISPRessoBatch. commit 1821ca5029c5a1485733f13ab3f2048b4f1fa04e Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Sep 15 15:49:08 2022 -0400 Version bump to 2.2.10 commit c5f79aebfc1ae209f4ee320df250eed89a02787c Author: Cole Lyman <Cole@colelyman.com> Date: Wed Sep 14 14:24:55 2022 -0600 Parallel plot refactor (#247) * Fix duplicate plotting in CRISPRessoBatch aggregate * Refactor mulltiprocessing plots in CRISPRessoBatch * Refactor multiprocessing plots in CRISPRessoCORE * Refactor multiprocessing plots for CRISPRessoAggregate commit 4ed5e24e6cc1dd8068e2391573ae2438acd32db2 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Sep 13 14:12:11 2022 -0400 print files in curr dir if Aggregate can't find files commit ce25bc06f29988e7a10afd0b6a09ba0caf0950e0 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Sep 12 10:32:57 2022 -0400 Spelling typo commit c15f01c75083403f17c58c121b2afe97e9f2a1ec Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Sep 6 17:49:52 2022 -0400 Add helper function to create alignment scoring matrix New scoring matrix can be created using CRISPResso2Align.make_matrix() commit c80f82838c5a228b79ad4484092877cfee08e02c Author: Cole Lyman <Cole@colelyman.com> Date: Mon Aug 22 18:28:33 2022 -0600 Add `zip_output` (#240) * Making zip of results * Zip command added, if zip is true place_report_in_output_folder is also true, zip removes all files while zipping * Adding --zip to compare and pooled/wgs compare * Add more formatting changes to CRISPRessoShared * Refactoring propagate_crispress_options so only one version exists * Zip added to arguments_to_ignore and warning added when changing arguments * Restore styling * Update README to include --zip * Rename --zip to --zip_output * Change --zip to --zip_output in CompareCORE and PooledWGSCompareCORE * Bug fix arg to args Co-authored-by: Samuel Nichols <Snic9004@gmail.com> commit 5de3d7286d8e33c7cf4d3615fce715806e72f511 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Aug 11 21:42:34 2022 -0400 Fix fix to aggregate for CRISPRessoWGS commit a2294c266f43b14969a5d6474076f31a77a57173 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Aug 11 21:40:50 2022 -0400 Fix bug in aggregate for WGS commit 7ce3eb4abe4b8ceac933272ac9cb16a8bedf26a3 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Aug 8 21:53:45 2022 -0400 Update CRISPRessoWGS to allow non-word characters in region names commit 040ac0033d6e250f4e3a412101874cf5e914e08a Author: kclem <k.clement.dev@gmail.com> Date: Mon Aug 8 16:04:59 2022 -0400 Enable processing of cram files by CRISPRessoWGS Adds --reference to samtools view when viewing cram files commit cf112a0caba8789e28530cc09171285ec6ea9b4c Author: kclem <k.clement.dev@gmail.com> Date: Mon Aug 8 14:55:46 2022 -0400 Auto amplicon detection for interleaved input Enables processing of interleaved fastq files for guess_guides and guess_amplicons, as well as get_most_frequent_reads. When interleaved input is present, the input is first separated into R1/R2 files, then processing is performed. commit 4ba524dc7b947feca8a0f743837844f9febc2171 Author: Cole Lyman <Cole@colelyman.com> Date: Thu Aug 4 11:32:11 2022 -0600 Potential fix for aggregate plots in Batch mode (#237) commit 6097a8a104d3f156ef7c08e196ac37e32bf04c71 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jul 21 22:45:48 2022 -0400 Fix pct_vectors in crispresso2_info json object commit 65a079d86d6f386793397398f839c46014b54543 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed Jul 20 23:46:37 2022 -0400 Fix more readme spelling bugs commit e817376ecd54cdea1f29e303ca25b9e7d1d38333 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed Jul 20 23:42:23 2022 -0400 Fix bug in readme spelling commit 49740ba1d66ed6d13a9e154b8b17bc8b5186581d Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed Jul 20 16:10:09 2022 -0400 Fix loading of crispresso info from WGS and Pooled commit b68a43271115251b18e8955e285ccc18f549e8cd Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jul 14 14:11:04 2022 -0400 Add plotly to dockerfile commit b0b7d41d697304d0d5fc93e3346c9de1b98ba41d Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jul 14 14:10:00 2022 -0400 Fix #231 Allow N's in bam output (Try 2) commit c460b3e73fd06a230dbac2e37c86b833144ebf94 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jul 14 14:09:10 2022 -0400 Revert "Fix #231 Allow N's in bam output" This reverts commit 2f6ad1dbe05210af9ccc1b1f17783cd212a888d3. commit 2f6ad1dbe05210af9ccc1b1f17783cd212a888d3 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jul 14 13:52:37 2022 -0400 Fix #231 Allow N's in bam output commit 0a2419e518dc9b3520058c3927f98b31cd51347e Author: Cole Lyman <Cole@colelyman.com> Date: Fri Jul 8 21:10:01 2022 -0600 Fix bug when name is provided instead of amplicon_name in pooled input file (#229) Also, raise an exception (instead of incorrectly executing) when there are not enough matched parameters in the pooled input file. commit cb58212379803788c04ca5793baaa760cbbeaa81 Author: Cole Lyman <Cole@colelyman.com> Date: Fri Jul 8 21:09:49 2022 -0600 Fix bug when comparing two samples with the same name. (#228) commit e8a796f5f451409cbafed4404dfba4b6b8a124ca Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jun 23 21:30:23 2022 -0400 Version bump to 2.2.9 commit 632143ddedea48bab9229baeb4bf3ea4d1f658d6 Author: Cole Lyman <Cole@colelyman.com> Date: Mon Jun 20 19:53:14 2022 -0600 Don't run global frameshift plot when there are no reads (#226) When there are no reads (i.e. global_MODIFIED_FRAMESHIFT + global_MODIFIED_NON_FRAMESHIFT + global_NON_MODIFIED_NON_FRAMESHIFT == 0) there was a bug when trying to compute the pie chart, because all of the values in the pie chart are 0. This fix, will make sure that there is at least one read in order for the plot to bee constructed properly. commit 4bb06218e835d2624d53fd401542caef6f8a3a55 Author: kclem <k.clement.dev@gmail.com> Date: Fri Jun 3 16:57:02 2022 -0400 Improvements for guide inference in 'auto' mode In 'auto' mode, a putative guide sequence is selected at the site of maximal editing. If the site of maximal editing happens near the end of the guide (e.g. base 0) many things will break (e.g. quantification windows, etc). This update excludes bases from being used to find the guide using the --exclude_bp_from_left and --exclude_bp_from_right parameters. At default, these parameters are 15bp, so the first and last 15bp would not be selected for the site of maximal editing and thus be the site of a guide sequence. In addition, the site of maximal editing must have 3x the magnitude over the background. commit 9d64de187835b2553ad2b4374d32edab27f83645 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jun 2 20:22:25 2022 -0400 Update README.md commit 6aafc5387986f5089ba55b68d128343d68052792 Author: Simon P Shen <sshen8@users.noreply.github.com> Date: Tue May 31 17:42:53 2022 -0400 directory in quotes in batch cmd (#222) Add quotes around output folder for folders that have spaces. commit 432f163ac68b9a650d1fd326171aadc505ee87f4 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue May 24 23:38:36 2022 -0400 CRISPRessoBatch fills NA values in batch settings NA values in CRISPRessoBatch are filled with the value from args - either the default value or the value from the command line args (if set) commit 6de774adbad3aa8cd99d07b0ba7692984b356cd4 Author: kclem <k.clement.dev@gmail.com> Date: Mon May 23 14:18:02 2022 -0400 Fix file naming bug for HDR outputs In html file, figures 4e and 4f incorrectly referenced figure 4d. This fixes this bug. commit b88fec0668a4082a12ead3d26582e86d829dd7cc Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sat May 21 00:32:15 2022 -0400 For bam_output, fix bug that wrote unaligned lines twice commit 3564e77ebcdedb4b01cc01dcca18ba3221fac67c Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu May 19 16:32:18 2022 -0400 Update README with CRISPRessoPooled headers and bam_output parameters commit bc08d81f17cb1929d1c37a1773cffcf36fb12fe2 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu May 19 16:11:30 2022 -0400 Add more links to tools commit 006c497a379ecd94b017a883a5db887861e1586a Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu May 19 16:08:14 2022 -0400 Add links to tools commit dc8243373ad00d6bd467fc30c59942596ff0c5d6 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon May 16 21:38:06 2022 -0400 fastq_to_bam implementation (#219) commit e88b6833977c6b2768299e0b2e7af623e3a9ae7c Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sun May 8 02:14:13 2022 -0400 Fix bug for when guides don't agree in CRISPRessoAggregate commit 7eb763116a8c60603f1cd654645215767ee8eb52 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu May 5 03:28:21 2022 -0400 Fix bug for case of empty summary plots in report generation commit 0324fa67d14ed945f0c9531d9bcf73ebcf4ca042 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu May 5 03:28:02 2022 -0400 Create report for number of significant bases in CRISPRessoCompare commit e3c9d0026a9ee6732f3ed6bdcf2a824850d7e66a Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 22:43:11 2022 -0400 Update pickle to json in readme and CRISPRessoPooledWGSCompare commit 1553f7977c12bf1091a20ca55b878bccfb739b61 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 18:10:04 2022 -0400 Merge pull request #4 from pinellolab/master (#218) commit bcecbfc047d294e26f381a6668e08cb4db24445c Merge: 15b0e05b bb13e007 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 18:06:37 2022 -0400 Merge branch 'master' into master commit bb13e007738d6e7a4909e01f03daff592f334f36 Merge: af4ab6e8 d0b41483 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 17:59:32 2022 -0400 Merge branch 'master' of https://github.com/edilytics/CRISPResso2 commit 15b0e05b9e03bbec5236e58776ddf9aa2f93180e Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 17:54:52 2022 -0400 2 flexible pooled input (#217) * Batch type coerce and r2 file check * Upgrade tabs for bootstrap5 * Update readme with additional pooled amplicon file headers Co-authored-by: Samuel Nichols <Snic9004@gmail.com> commit d0b41483bee704940ba60c58289f412b04c71659 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 13:43:43 2022 -0400 Update README.md commit ce49fab5301cb73ba0daf6c765e350eb083c76f1 Merge: 5f909713 b913fcb4 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 13:40:30 2022 -0400 Merge pull request #3 from edilytics/2-flexible-pooled-input Add flexibility to CRISPRessoPooled amplicon input by allowing headers. Also, prime editing and quantification window coordinate parameters can be passed to CRISPRessoPooled. commit b913fcb402a8ba3106c3ff7913563a33d8d19fca Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 13:38:25 2022 -0400 Update CRISPRessoPooledCORE.py Replace process to read header, increase flexibility for column order commit 945bf31f16530b7ce25b89095b2c7005bf146117 Merge: 7b8f6788 5f909713 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 12:45:24 2022 -0400 Merge branch 'master' into 2-flexible-pooled-input commit 5f9097133765736a7c2fe3c8e9b730845fed0b70 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 12:23:44 2022 -0400 Version bump to 2.2.8 commit c4a94ce0e06c6ebae13e128fbe6b708e635121c4 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 00:13:17 2022 -0400 Fix summary plot representation for multi reports *fixed old reference to make_multi_report which called old summary plot format * renamed summary_plot to summary_plots to reflect a dict with multiple plots commit 62900e9ae6fa37ce99a04f12a63ed5c912f75042 Author: Cole Lyman <Cole@colelyman.com> Date: Tue May 3 20:47:52 2022 -0600 Large aggregation (#192) * Squashed commit of the following: commit 8564eb03f0d9e62abf4b7528baf5c2ae296be8f9 Merge: f6ef62c 07cc7d8 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Jan 11 16:20:15 2022 -0500 Merge branch 'indel-alignment-fix' of https://github.com/edilytics/CRISPResso2 into indel-alignment-fix commit 07cc7d856ab3fcbbaa5381f17f29568192388887 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:29:59 2021 -0700 Fix bug in `find_indels_substitutions` This bug occurred when there was a deletion at the end of a sequence, and was thus not properly accounted for. commit f6ef62cfdf909adac1b10ea86555cd218f8b2a74 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:29:59 2021 -0700 Fix bug in `find_indels_substitutions` This bug occurred when there was a deletion at the end of a sequence, and was thus not properly accounted for. commit 7212f87f4be60057a6c848947ff6b5efde132a25 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:26:17 2021 -0700 Add a unit test for `find_indels_substitutions` This unit test checks for deletions at the end of a sequence, which are inherently outside of the include_indx_set window. commit d50b4e903b973c71a275e31d470b40e59280ee13 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:03:22 2021 -0700 Fix a bug in `find_indels_substitutions` The bug that this commit fixes is when an insertion occurs at the edge of the include indexes. The trouble with this earlier was that it was using the `idx` to calculate the size of the insertion, but the `idx` wasn't being incremented anymore because it was outside of the include window. commit 4db066f7bc333b7662a9232ac732ebb33ac3ace8 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:01:39 2021 -0700 Add test case for `find_indels_substitutions` This test case is extracted from the CRISPRessoBatch integration test and provides an example where there is an insertion at the edge of the include index. commit 3b3a7417f5bbd6c2785a2af54a47e01d2e820451 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 11:37:07 2021 -0700 Fix bug in CRISPRessoCompare where sample names were not properly set This was a place where it was (partially) missed during the crispresso2_info object refactoring. commit e9f5eff3d95b676b5ee2e23371a5604f600d34b2 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:26:17 2021 -0700 Add a unit test for `find_indels_substitutions` This unit test checks for deletions at the end of a sequence, which are inherently outside of the include_indx_set window. commit d4d45a918254ab19a7e7956e9e731389c6f36ecb Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:03:22 2021 -0700 Fix a bug in `find_indels_substitutions` The bug that this commit fixes is when an insertion occurs at the edge of the include indexes. The trouble with this earlier was that it was using the `idx` to calculate the size of the insertion, but the `idx` wasn't being incremented anymore because it was outside of the include window. commit 13f00bb40239c83e6e5cf844561fdb7000d3d9ab Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:01:39 2021 -0700 Add test case for `find_indels_substitutions` This test case is extracted from the CRISPRessoBatch integration test and provides an example where there is an insertion at the edge of the include index. commit 659ae34e8fd106f7ecc163b5bea0b5a80ab0283c Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 11:37:07 2021 -0700 Fix bug in CRISPRessoCompare where sample names were not properly set This was a place where it was (partially) missed during the crispresso2_info object refactoring. * Add parameter `--suppress_batch_summary_plots` If many runs are run at the same time, batch summary plots may fail because they are too large for matplotlib. This parameter `--suppress_batch_summary_plots` allows individual runs to be plotted, but suppresses batch summary plots that may otherwise be too big. * Pep formatting cleanup * Add summary nucleotide plots to aggregate * Aggregate plots are paginated * Update CRISPRessoAggregateCORE.py Remove max sample limit for plotting * Add --max_samples_per_summary_plot to CRISPRessoAggregate Parameterize the max number of samples to plot on each page of reports. Additional PDFs will be created with this number of samples on them. * Add plotly function to plot an interactive heatmap * Fix deprecated numpy type to suppress warning * Add plotting of heatmaps to CRISPRessoAggregateCORE to summarize modification types These heatmaps are interactive (zoomable and panable) and show for each sample the percentage of insertions, substitutions, and deletions. * Add the heatmap summaries to the CRISPRessoAggregate report * Update Bootstrap to 5.1.3 This is mainly so that we can use the fullscreen modal functionality in this version. * Move the plotly heatmaps to a Bootstrap modal * Fix bug where plots were not filling up entire modal. I have tried countless different ways for this to work, and this is the best that I can come up with. After the modal is opened it triggers the plot to resize, and then for some reason you need to trigger the resize event. I think this is because a `div` changing size won't actually trigger the resizing of the plot (and neither will just calling `Plotly.Plots.resize`...?!). * Update the axis labels and add autosize to plotly heatmaps I'm pretty sure the autosize doesn't do anything, but it is there for good measure. * Abandon attempts to make plots fullscreen This includes removing the Bootstrap modal (two out of the three plots would resize properly and I couldn't figure out a way to have the plot displayed outside of the modal). I have left in some javascript to make the plot fullscreen, but I couldn't get the formatting quite right and the plot wasn't much bigger in the fullscreen version because there was a ton of space between the plot and the heatmap. If some brave soul would like to tackle it, feel free! * Rename and refactor how plot data is passed around I have consolidated how the plot data is passed around, so that now you can pass in only one dict with all of the information instead of 4 or 5 separate parameters. I also renamed the `heatmap_plot_*` to `allele_modification_heatmap_*`. * Implement the line plot version of the modification percentages This also includes correctly resizing the plot when the line plot tab is selected! * Change default `max_samples_per_summary_plot` to be 150 instead of 250 * Remove extra assignments of `this_number_samples` and suppress plot The plot that is suppressed is the large nucleotide quilt when there is a large number of samples. Is it okay to suppress this plot @kclem? * Implement parallel plotting in CRISPRessoAggregate * Fix sample indexing error and heatmap scaling for large number of samples * Add parameter `--suppress_batch_summary_plots` If many runs are run at the same time, batch summary plots may fail because they are too large for matplotlib. This parameter `--suppress_batch_summary_plots` allows individual runs to be plotted, but suppresses batch summary plots that may otherwise be too big. * Pep formatting cleanup * Add summary nucleotide plots to aggregate * Aggregate plots are paginated * Update CRISPRessoAggregateCORE.py Remove max sample limit for plotting * Add --max_samples_per_summary_plot to CRISPRessoAggregate Parameterize the max number of samples to plot on each page of reports. Additional PDFs will be created with this number of samples on them. * Add plotly function to plot an interactive heatmap * Fix deprecated numpy type to suppress warning * Add plotting of heatmaps to CRISPRessoAggregateCORE to summarize modification types These heatmaps are interactive (zoomable and panable) and show for each sample the percentage of insertions, substitutions, and deletions. * Add the heatmap summaries to the CRISPRessoAggregate report * Update Bootstrap to 5.1.3 This is mainly so that we can use the fullscreen modal functionality in this version. * Move the plotly heatmaps to a Bootstrap modal * Fix bug where plots were not filling up entire modal. I have tried countless different ways for this to work, and this is the best that I can come up with. After the modal is opened it triggers the plot to resize, and then for some reason you need to trigger the resize event. I think this is because a `div` changing size won't actually trigger the resizing of the plot (and neither will just calling `Plotly.Plots.resize`...?!). * Update the axis labels and add autosize to plotly heatmaps I'm pretty sure the autosize doesn't do anything, but it is there for good measure. * Abandon attempts to make plots fullscreen This includes removing the Bootstrap modal (two out of the three plots would resize properly and I couldn't figure out a way to have the plot displayed outside of the modal). I have left in some javascript to make the plot fullscreen, but I couldn't get the formatting quite right and the plot wasn't much bigger in the fullscreen version because there was a ton of space between the plot and the heatmap. If some brave soul would like to tackle it, feel free! * Rename and refactor how plot data is passed around I have consolidated how the plot data is passed around, so that now you can pass in only one dict with all of the information instead of 4 or 5 separate parameters. I also renamed the `heatmap_plot_*` to `allele_modification_heatmap_*`. * Implement the line plot version of the modification percentages This also includes correctly resizing the plot when the line plot tab is selected! * Change default `max_samples_per_summary_plot` to be 150 instead of 250 * Remove extra assignments of `this_number_samples` and suppress plot The plot that is suppressed is the large nucleotide quilt when there is a large number of samples. Is it okay to suppress this plot @kclem? * Implement parallel plotting in CRISPRessoAggregate * Fix sample indexing error and heatmap scaling for large number of samples * Add plotly requrement to setup.py * Remove space around vertical barcharts * Add scrollbar to long images in multiReport * Fill in default (empty) values to allele modification plots When not running CRISPRessoAggregate, default values for the `allele_modification_heatmap_plot` and `allele_modification_lin_plot` dictionaries will be set so that the template can be properly rendered. * Include CRISPRessoBatch in the refactor of how summary_plot dicts are handled * Update dockerfile for new docker * minor bug fixes for plotCustomAllelePlot.py to work with Python3 (#212) * Allow for flexible parsing of quant window coordinates * CRISPRessoPooled debug flash command, fix pep formatting * Set flexiguide homology parameter type to int * Coerce ints in batch file checking (#200) * Batch type coerce and r2 file check * Revert "Batch type coerce and r2 file check" This reverts commit f91736688ea9739cf3063e3601c52ad6da1116a4. * Coerce int values * Handle multiple qwcs in batch mode If multiple qwcs were provided in batch mode, a parsing error would occur. This fixes this bug. * Fix bug from old pandas for int cols Evidently old pandas versions throw an error if a column doesn't exist. This checks to see if the column exists before the values are set. * Create allele modification heatmaps and line plots in CRISPRessoBatch * Add allele modification heatmaps and line plots to CRISPRessoBatch * Make all plots in CRISPRessoBatch run in parallel * Make `--suppress_batch_summary_plots` store true Also, only open and shutdown the process pool when necessary. * Add blank values for allele_modification entries when not present Co-authored-by: Kendell Clement <k.clement.dev@gmail.com> Co-authored-by: dharjanto <dewi.harjanto@gmail.com> Co-authored-by: Samuel Nichols <Snic9004@gmail.com> commit f67376fc9ab0e407d4086aa42fd1c77706ebc9c0 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Fri Apr 15 00:46:30 2022 -0400 Fix bug from old pandas for int cols Evidently old pandas versions throw an error if a column doesn't exist. This checks to see if the column exists before the values are set. commit b34fe2956ff88629809b2434878028723dfc4895 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Apr 14 23:58:07 2022 -0400 Handle multiple qwcs in batch mode If multiple qwcs were provided in batch mode, a parsing error would occur. This fixes this bug. commit c94e3b9f2e301bda91e9c1e6f4ef794b33b5dbf0 Author: Samuel Nichols <Snic9004@gmail.com> Date: Thu Apr 14 21:48:32 2022 -0600 Coerce ints in batch file checking (#200) * Batch type coerce and r2 file check * Revert "Batch type coerce and r2 file check" This reverts commit f91736688ea9739cf3063e3601c52ad6da1116a4. * Coerce int values commit fc4542491bb86eb143db0044a848a56234403496 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Apr 14 22:13:23 2022 -0400 Set flexiguide homology parameter type to int commit 23fe2aa8e26067d1bcf36bfafc67e023c7588d2f Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Apr 14 22:12:37 2022 -0400 CRISPRessoPooled debug flash command, fix pep formatting commit d292d33d8c1fa3bfd2cee656643fd47bcdab161d Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Apr 14 22:00:19 2022 -0400 Allow for flexible parsing of quant window coordinates commit e1667cb53a7ea6fbb33369c8530a78639ed423ec Author: dharjanto <dewi.harjanto@gmail.com> Date: Mon Apr 11 22:08:21 2022 -0400 minor bug fixes for plotCustomAllelePlot.py to work with Python3 (#212) commit 7b8f6788da18f6ab173fa3c3d10f4ab6bb2acc26 Author: Samuel Nichols <Snic9004@gmail.com> Date: Fri Apr 8 10:21:00 2022 -0600 Update README commit 9bc24cd0474ed9f398dff64274d3181c4b2f8637 Author: Samuel Nichols <Snic9004@gmail.com> Date: Tue Mar 29 11:25:09 2022 -0600 Using Amplicon_Name commit 88ac5d72074b3da63de035e02c911ce34cd29414 Merge: b6057a2d e5afa478 Author: Samuel Nichols <Snic9004@gmail.com> Date: Mon Mar 28 22:32:09 2022 -0600 Merge remote-tracking branch 'origin/master' into 2-flexible-pooled-input commit b6057a2d54cb8637ff0900416de8e2de72213f76 Author: Samuel Nichols <Snic9004@gmail.com> Date: Mon Mar 28 20:53:05 2022 -0600 Printing info statements for matched headers commit af4ab6e8507d7aa4b7b68f217a458e0d9c966f55 Merge: bbb7d6f0 51a943c3 Author: Cole Lyman <Cole@colelyman.com> Date: Fri Mar 25 09:44:13 2022 -0600 Merge branch 'pinellolab:master' into master commit 3c1eb012fc02563e3e963f17a62c7e932f5bcddc Author: Samuel Nichols <Snic9004@gmail.com> Date: Thu Mar 24 12:31:43 2022 -0600 Debugging and column checking commit 0b47acbc592a6df6adf14641357b2104b76be691 Author: Samuel Nichols <Snic9004@gmail.com> Date: Wed Mar 23 09:42:51 2022 -0600 New variables added to pooled commit a0ff3a44d6d19d7b37f91919b5c0180206f72d53 Author: Samuel Nichols <Snic9004@gmail.com> Date: Mon Mar 21 09:32:28 2022 -0600 Read as string not bytes commit 710675fc3c0307e21103abd604315b47ff80a894 Author: Samuel Nichols <Snic9004@gmail.com> Date: Wed Mar 16 13:51:30 2022 -0600 Adding command building for new options commit f386818a48e5c840bd567611e6f1320c8146cac7 Author: Samuel Nichols <Snic9004@gmail.com> Date: Wed Mar 16 10:08:33 2022 -0600 Comment out df_template.iloc instance commit eb5e309da57c8b96cd760728ddbf67be05f30d1c Author: Samuel Nichols <Snic9004@gmail.com> Date: Wed Mar 16 09:59:19 2022 -0600 Potential solution for flexible headers commit 51a943c3a8f8181963acc420e75a5e8ee103cf7c Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Mar 15 11:00:46 2022 -0400 CRISPRessoPooled pep formatting and fix CRISPRessoPooled doesn't re-count reads if it has been run once and the `aligned_pooled_bam` is provided as input pep code formatting changes commit bbb7d6f0907aa13518d20e7f470e7de518b825f4 Merge: ddbd39f0 5a10d638 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Mar 15 10:23:38 2022 -0400 Merge branch 'master' of https://github.com/edilytics/CRISPResso2 commit 5a10d638c638f21f8a2934955e92ef7e117b889e Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sat Feb 26 14:21:57 2022 -0500 Move metadata for bam input and output commit e5afa4784d5330a1dc95c5deafcd9217edeac631 Author: Samuel Nichols <Snic9004@gmail.com> Date: Wed Feb 16 10:20:24 2022 -0700 Coerce int values commit ede7d85b50055311908000578c76a1860ae9de4d Author: Samuel Nichols <Snic9004@gmail.com> Date: Wed Feb 16 10:18:29 2022 -0700 Revert "Batch type coerce and r2 file check" This reverts commit f91736688ea9739cf3063e3601c52ad6da1116a4. commit f91736688ea9739cf3063e3601c52ad6da1116a4 Author: Samuel Nichols <Snic9004@gmail.com> Date: Wed Feb 16 10:10:52 2022 -0700 Batch type coerce and r2 file check commit 7b4a310b0f8b64c00e02eca3d522ad50d39b43ae Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Feb 15 22:18:05 2022 -0500 Reiterate WGS region file is tab-separated Add note to WGS description that region file should be tab-separated. Closes #199 commit b8497542e388ad401d0815d426f27abc3201a76d Author: kclem <k.clement.dev@gmail.com> Date: Fri Feb 11 15:07:14 2022 -0500 Extend x-axis to longest scaffold incorporation length commit ab7248947afade089809c74bfe6e9d5394e8f6dc Author: kclem <k.clement.dev@gmail.com> Date: Wed Feb 9 17:05:11 2022 -0500 Fix prime editing indexing for plots commit ddbd39f06b262d5ebd2cc69e116c08b22b6bd84e Merge: a7ffd468 442a48c7 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jan 13 15:35:36 2022 -0500 Merge branch 'pinellolab:master' into master commit 442a48c7f4c62ec2ebc95fe268475e5e2a4b2f0c Author: Cole Lyman <Cole@colelyman.com> Date: Tue Jan 11 15:28:28 2022 -0700 Indel alignment fix (#182) * Fix bug in CRISPRessoCompare where sample names were not properly set This was a place where it was (partially) missed during the crispresso2_info object refactoring. * Add test case for `find_indels_substitutions` This test case is extracted from the CRISPRessoBatch integration test and provides an example where there is an insertion at the edge of the include index. * Fix a bug in `find_indels_substitutions` The bug that this commit fixes is when an insertion occurs at the edge of the include indexes. The trouble with this earlier was that it was using the `idx` to calculate the size of the insertion, but the `idx` wasn't being incremented anymore because it was outside of the include window. * Add a unit test for `find_indels_substitutions` This unit test checks for deletions at the end of a sequence, which are inherently outside of the include_indx_set window. * Fix bug in CRISPRessoCompare where sample names were not properly set This was a place where it was (partially) missed during the crispresso2_info object refactoring. * Add test case for `find_indels_substitutions` This test case is extracted from the CRISPRessoBatch integration test and provides an example where there is an insertion at the edge of the include index. * Fix a bug in `find_indels_substitutions` The bug that this commit fixes is when an insertion occurs at the edge of the include indexes. The trouble with this earlier was that it was using the `idx` to calculate the size of the insertion, but the `idx` wasn't being incremented anymore because it was outside of the include window. * Add a unit test for `find_indels_substitutions` This unit test checks for deletions at the end of a sequence, which are inherently outside of the include_indx_set window. * Fix bug in `find_indels_substitutions` This bug occurred when there was a deletion at the end of a sequence, and was thus not properly accounted for. * Fix bug in `find_indels_substitutions` This bug occurred when there was a deletion at the end of a sequence, and was thus not properly accounted for. * Squashed commit of the following: commit 8564eb03f0d9e62abf4b7528baf5c2ae296be8f9 Merge: f6ef62c 07cc7d8 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Jan 11 16:20:15 2022 -0500 Merge branch 'indel-alignment-fix' of https://github.com/edilytics/CRISPResso2 into indel-alignment-fix commit 07cc7d856ab3fcbbaa5381f17f29568192388887 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:29:59 2021 -0700 Fix bug in `find_indels_substitutions` This bug occurred when there was a deletion at the end of a sequence, and was thus not properly accounted for. commit f6ef62cfdf909adac1b10ea86555cd218f8b2a74 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:29:59 2021 -0700 Fix bug in `find_indels_substitutions` This bug occurred when there was a deletion at the end of a sequence, and was thus not properly accounted for. commit 7212f87f4be60057a6c848947ff6b5efde132a25 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:26:17 2021 -0700 Add a unit test for `find_indels_substitutions` This unit test checks for deletions at the end of a sequence, which are inherently outside of the include_indx_set window. commit d50b4e903b973c71a275e31d470b40e59280ee13 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:03:22 2021 -0700 Fix a bug in `find_indels_substitutions` The bug that this commit fixes is when an insertion occurs at the edge of the include indexes. The trouble with this earlier was that it was using the `idx` to calculate the size of the insertion, but the `idx` wasn't being incremented anymore because it was outside of the include window. commit 4db066f7bc333b7662a9232ac732ebb33ac3ace8 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:01:39 2021 -0700 Add test case for `find_indels_substitutions` This test case is extracted from the CRISPRessoBatch integration test and provides an example where there is an insertion at the edge of the include index. commit 3b3a7417f5bbd6c2785a2af54a47e01d2e820451 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 11:37:07 2021 -0700 Fix bug in CRISPRessoCompare where sample names were not properly set This was a place where it was (partially) missed during the crispresso2_info object refactoring. commit e9f5eff3d95b676b5ee2e23371a5604f600d34b2 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:26:17 2021 -0700 Add a unit test for `find_indels_substitutions` This unit test checks for deletions at the end of a sequence, which are inherently outside of the include_indx_set window. commit d4d45a918254ab19a7e7956e9e731389c6f36ecb Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:03:22 2021 -0700 Fix a bug in `find_indels_substitutions` The bug that this commit fixes is when an insertion occurs at the edge of the include indexes. The trouble with this earlier was that it was using the `idx` to calculate the size of the insertion, but the `idx` wasn't being incremented anymore because it was outside of the include window. commit 13f00bb40239c83e6e5cf844561fdb7000d3d9ab Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:01:39 2021 -0700 Add test case for `find_indels_substitutions` This test case is extracted from the CRISPRessoBatch integration test and provides an example where there is an insertion at the edge of the include index. commit 659ae34e8fd106f7ecc163b5bea0b5a80ab0283c Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 11:37:07 2021 -0700 Fix bug in CRISPRessoCompare where sample names were not properly set This was a place where it was (partially) missed during the crispresso2_info object refactoring. * Fix bug in `find_indels_substitutions` Th…
Snicker7
added a commit
to edilytics/CRISPResso2
that referenced
this pull request
Apr 4, 2024
commit 6f4b0ad885e1d72413a034bf7abaaa0360a3b0c4 Author: Samuel Nichols <Snic9004@gmail.com> Date: Thu Apr 4 15:18:09 2024 -0600 Batch d3 clean (#55) * imports C2Pro plots if available * added --use_matplotlib flag * added C2Pro matched api funciton signatures * added api args for plotly * added **kwargs * renamed config to custom_config, more specificity * added backend flag for plotly kaleido * added pro_installed boolean for templates, added plotly dependency to report templates * Squashed commit of the following: commit c909ea3b34e87ce637e00dac075d2bb2f8bfb954 Author: McKay <mbowcut@gmail.com> Date: Thu Feb 15 15:55:23 2024 -0700 added plotly dependency for pro commit 76b3601f6a0144f100266153f1c999e0c5de65de Author: Samuel Nichols <Snic9004@gmail.com> Date: Fri Jan 12 09:56:19 2024 -0700 Squashed commit of the following: commit 603f2eff9d1aa21ae95f3e134da303b8018d3a33 Author: Samuel Nichols <Snic9004@gmail.com> Date: Fri Jan 12 09:48:20 2024 -0700 fix guardrials partial commit 22fc03183a8070c30dfb74d5c23575ac19019855 Author: Samuel Nichols <Snic9004@gmail.com> Date: Fri Jan 12 08:54:01 2024 -0700 Add guardrail partial commit e55f6b21972b578261bc5a864ce1d653d98f9e34 Author: Samuel Nichols <Snic9004@gmail.com> Date: Mon Jan 8 07:50:59 2024 -0700 Functional guardrails, needs reports update commit 6e968e9699ed59a47d88191d03768e042d8b60a4 Merge: 32b49685 e948ce10 Author: Samuel Nichols <Snic9004@gmail.com> Date: Mon Dec 18 13:34:36 2023 -0700 Merge branch 'guardrails-clean-history' of https://github.com/edilytics/CRISPResso2 into guardrails-clean-history commit 32b49685da320501dad2b0ebbb57887b66220ba8 Author: Samuel Nichols <Snic9004@gmail.com> Date: Fri Dec 15 15:27:04 2023 -0700 Include guardrail functions commit 4e309cf6f732565d635de3d4c5d074ada3027e2d Author: Cole Lyman <cole@colelyman.com> Date: Mon Dec 18 10:51:55 2023 -0700 Refactor to use CRISPRessoReports module commit e648dc087c0055bc5d2fca13c64071a371dea941 Author: Cole Lyman <cole@colelyman.com> Date: Mon Dec 18 10:51:11 2023 -0700 Add CRISPRessoReports subtree commit e948ce107ebb0d1d99010ed12e937f34b5e607d4 Author: Samuel Nichols <Snic9004@gmail.com> Date: Fri Dec 15 15:27:04 2023 -0700 Include guardrail functions commit d33c748871a625facfe8d792e29c77ab9779138f Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Nov 7 16:31:06 2023 -0700 Include parameter --assign_ambiguous_alignments_to_first_reference in readme commit a1435f7f491a6a61434f3051e39f39a4c9bf1edc Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed Oct 11 17:17:30 2023 -0600 Enable quantification by sgRNA (#348) This PR includes: - storing the sgRNA-specific editing locations in the crispresso2_info object. Previously, each amplicon would record the indices of quantification windows across the guide, but not for individual guides. This stores the information for each guide in crispresso2_info['results']['refs'][reference_name]['sgRNA_include_idxs'] - a script (count_sgRNA_specific_edits.py) to parse through an allele table output from a completed CRISPResso run (`--write_detailed_allele_table` flag required) to count edits in each sgRNA separately. I don't have a good double-edited sample handy, but it can be run on the demo HDR data [hdr.fastq.gz](http://crispresso.pinellolab.org/static/demo/hdr.fastq.gz) using the command: ``` CRISPResso -r1 hdr.fastq.gz -a acatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgTggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttggtatcaaggtta -e acatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcaCctgactccGgaggagaagtctgccgttactgcGctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttggtatcaaggtta -c atggtgcatctgactcctgTggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcag -g TGCACCATGGTGTCTGTTTG,GATGAAGTTGGTGGTGAGGCCC --write_detailed_allele_table -n hdr3 -p max -gn guide1,guide2 ``` ``` python CRISPResso2/scripts/count_sgRNA_specific_edits.py -f CRISPResso_on_hdr3 ``` This produces: ``` Processed 25000 alleles Reference: Reference (2391/23415 modified reads) UNMODIFIED: 21024 MODIFIED guide1: 2359 MODIFIED guide2: 32 Reference: HDR (856/1577 modified reads) UNMODIFIED: 721 MODIFIED guide1: 854 MODIFIED guide1 + guide2: 1 MODIFIED guide2: 1 ``` commit 2e3da02fdbed2fa8ae02a277763d65a502459827 Author: Cole Lyman <Cole@colelyman.com> Date: Tue Oct 10 15:29:08 2023 -0600 changed tuple to list for matplotlib change (#31) (#346) Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com> commit cd3c332135fe4db0f9218e3d87263d5c65838ed9 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sun Oct 1 01:54:46 2023 -0600 rename script to camel case commit 7c719d65fb36ac7654db9040f226564ea28fcab9 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sun Oct 1 01:53:44 2023 -0600 Add new script for counting high quality bases commit f97cd2795e89464bcc9321ccfdbca3e6af2bcb4f Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Sep 14 15:15:30 2023 -0600 Prime editing alignment params (#336) Adds two parameters to control alignment of pegRNA components: --prime_editing_gap_open_penalty and --prime_editing_gap_extend_penalty. CRISPResso checks to see whether the pegRNA spacer and extension sequence are in the correct orientation, but sometimes they could align in the incorrect orientation with a higher score (e.g. via insertion of multiple gaps, whereas a single long gap would be preferred). Introducing these two parameters allows users to adjust the alignment parameters specifically for these prime-editing checks without adjusting the global alignment parameters which will be applied to reads that are aligned to the WT reference/prime-editing reference sequences. The new prime_editing_gap_open_penalty is set to -50, a higher gap open penalty than the default needleman_wunsch_gap_open penalty (-20). This commit breaks backward-reproducibility, but mostly in the checking of pegRNA component orientation - so previously some CRISPResso runs would have failed and produced an error, but now they will (hopefully) succeed. To achieve complete backward reproducibility, add the flag --prime_editing_gap_open_penalty -20 to runs. commit 64cbf36dae85cffa2c15e73f2a7ee8aa1077d917 Author: Cole Lyman <Cole@colelyman.com> Date: Thu Sep 7 16:43:30 2023 -0600 Fix samtools piping (#325) * Remove samtools pipe stderr to stdout Sometimes some of the libraries that samtools depends on don't have the correct version information, and as such samtools will report this to stderr when run. Because we pipe the output of samtools, we expect it to be valid SAM format, but when these library version messages are reported, it breaks CRISPRessoWGS. * Remove extra spacing at end of lines and add missing comma in WGS * Log stderr from samtools in CRISPRessoWGS commit 8feff4101f27406d9d88ace97d31a518276bff3f Author: Cole Lyman <Cole@colelyman.com> Date: Fri Sep 1 09:43:56 2023 -0600 Replace link to CRISPResso schematic with raw URL in README (#329) * Replace link to CRISPResso schematic with raw URL * Add new lines to the beginning of unordered lists commit 2e9e6bff5bcc536d5e2ba1440d1ab96d9d47efd6 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Aug 10 00:52:12 2023 -0600 Try to unbreak CircleCI commit ae5b95246cb0f6d66c4cbfb50cf8f5a9626b0827 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Aug 10 00:17:27 2023 -0600 Center command line text messages commit 4d9c71ecf2248c9bb1e10430178dc318b6621c8b Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Aug 10 00:17:07 2023 -0600 Fix bug in prime-editing scaffold-incorporation plotting If read is too short, scaffold incorporation detection will fail because it will check beyond the length of the read. commit 2b36a1a5c35e8a93516ce8baf464595615e0f402 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed Aug 9 15:29:48 2023 -0600 CRISPRessoPooled --compile_postrun_references bug fixes commit 3e04d1d402bcf95edd39fc7c8c9af61bb380f9db Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Aug 8 23:30:15 2023 -0600 Fix missing ' in Pooled --demultiplex_only_at_amplicons commit 06af527f9e2020c5cf251e7f1cec0b1eca1c1664 Author: Cole Lyman <Cole@colelyman.com> Date: Mon Jul 24 10:47:46 2023 -0600 Sort pandas dataframes by # of reads and sequences so that the order is consistent (#316) * Make sorting stable * Including c files * Sort by #Reads instead of %Reads to avoid floating point errors --------- Co-authored-by: Samuel Nichols <Snic9004@gmail.com> commit de05533b3511a84f3b6b14fc2ef64db041613261 Author: Cole Lyman <Cole@colelyman.com> Date: Thu Jul 6 13:54:45 2023 -0600 Fix multiprocessing lambda pickling (#311) * Fix running plots in parallel The reason the plots were running slower before this change is because I was calling the plot function, not passing it to `submit`. So it was essentially running in serial, but worse because it was still spinning up/down the processes. * Fix multiprocessing lambda pickling (#20) * Refactor process_futures to be a dict This makes debugging much easier because you can associate the arguments to the future with the results. * Fix the pickling error when running in multiprocessing Only top-level functions (not lambdas) can be pickled to use in multiprocessing pools, thus the lambdas are converted to a regular function. * Further fixes to pickling multiprocessing error (#21) * Refactor process_futures to be a dict This makes debugging much easier because you can associate the arguments to the future with the results. * Fix the pickling error when running in multiprocessing Only top-level functions (not lambdas) can be pickled to use in multiprocessing pools, thus the lambdas are converted to a regular function. * Use Counter instead of defaultdict in CRISPRessoCORE * Update process_futures to dict in Batch and Aggregate commit ebb016dff46c280dce8c3c09e8ac0e0cc25d4d74 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Jul 3 17:12:09 2023 -0600 Enable CRISPRessoPooled multiprocessing when os allows multi-thread file append commit 7285da0e987b77b72c8885bb35940e0f50c146bd Author: Kendell Clement <k.clement.dev@gmail.com> Date: Fri Jun 23 16:50:33 2023 -0600 Fix print bug for invalid fastq commit 9acdeac67441f9a1d55ac94b153bcb68fb89b92c Author: kclem <k.clement.dev@gmail.com> Date: Wed Jun 21 16:03:48 2023 -0600 Slugify before creating filename - replaces invalid characters in batch names with _ commit f97e29c67de4c80b8d6b9cf334f363be4b514ade Author: Cole Lyman <Cole@colelyman.com> Date: Wed Jun 21 14:43:43 2023 -0600 Add verbosity argument to CRISPRessoAggregate (#18) fixes #306 (#307) * Add verbosity argument to CRISPRessoAggregate (#18) * Allow for amplicon and guide seqs to be some variant of NA in batch (#19) This was discovered when attempting to infer amplicon sequences in batch mode on the web interface, NAs were supplied for the amplicon sequences to the sub CRISPResso commands. commit 32e1e9797da5c3033cdc588e92f06b8813961953 Author: Mark Clement <u0351481@notchpeak30.int.chpc.utah.edu> Date: Wed Jun 21 14:01:00 2023 -0600 Allow for interrogation of overlapping sgRNA sites commit 7248ba8c4deee125ad1ec12fdf1294a84d5f6f93 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Jun 12 12:16:47 2023 -0600 Check input fastq file format Asserts input format of fastq files - including if gzipped files are missing the gz suffix. commit 83c8ab8f462e7d8c1d04c08c1a398b874f517251 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Jun 5 13:41:55 2023 -0600 Fix CRISPRessoArgParser commit 14a2c8577f566e1b72d5f4e72cd6cd22079610be Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Jun 5 13:29:31 2023 -0600 Cosmetic updates for command-line use - version bump to 2.2.13 - If no args are provided, the command line version will print out an abbreviated help message - parameters can be excluded from CRISPRessoArgParser commit 1cd54bc1d03360c3d8121ba9e66b3589fe1cf252 Author: Cole Lyman <Cole@colelyman.com> Date: Thu May 11 14:31:47 2023 -0600 Fix multiprocessing error, don't start pool when only using single thread (#302) * Update README to have consistent use of `--base_editor_output` (#16) * Add files via upload * Only start process pools when using multiple processes This is mainly to solve the issue when running on AWS Lambda, but this should improve single core performance overall. --------- Co-authored-by: Kendell Clement <k.clement.dev@gmail.com> commit 92a705c939b370373a70cf6ae9f1616de33288b9 Author: Cole Lyman <Cole@colelyman.com> Date: Thu May 11 14:31:06 2023 -0600 Update `base_editor` parameters in README and add Plot Harness (#301) * Update README to have consistent use of `--base_editor_output` (#16) * Add files via upload --------- Co-authored-by: Kendell Clement <k.clement.dev@gmail.com> commit 7d46c4490235df45c5546b1b470e4e6a99727031 Author: Cole Lyman <Cole@colelyman.com> Date: Wed May 10 15:41:33 2023 -0600 Clarify CRISPRessoWGS intended use (#303) * Update README to have consistent use of `--base_editor_output` (#16) * Add sample plotting jupyter notebook * Add clarifying info to CRISPRessoWGS description Clarify WGS usage commit 833a701787bb47674b3e921c38cac6189c775cf7 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu May 4 17:02:46 2023 -0400 Remove debug print statements commit 712eb2a11825e8d36f2870deb12b35486bd633fb Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu May 4 16:40:07 2023 -0400 Allow dashes in filenames resolve #73 commit a439f094745b2b5e7f032f0777d4c67e6d6f93c5 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sat Apr 22 23:41:58 2023 -0400 Raise exceptions from within futures in plot_pool commit 7e807a60de2a9d18bccd034b87106ceaf7153338 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sat Apr 22 23:38:56 2023 -0400 Fix future pandas indexing warning Pandas error was "FutureWarning: Calling float on a single element Series is deprecated and will raise a TypeError in the future. Use float(ser.iloc[0]) instead" commit 304a92aa7a7ef8c705cb070dce25d9a2e5745ba9 Author: Cole Lyman <Cole@colelyman.com> Date: Thu Apr 20 13:59:27 2023 -0600 Remove debug print statements fixes #295 (#297) The format string option used here is only available in Python version >=3.8. commit 478c06f784603e96d20f96e91993fdcc4ac35c8a Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Apr 13 12:09:26 2023 -0400 Update plotCustomAllelePlot.py script for #292 (#293) Update type of 'max_rows' param to int Fix location of 'args' in crispresso2_info object commit bcdae39e05d530f4a4e78738c3b30f7664981919 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Mar 27 13:18:34 2023 -0400 Update pooled parameter format commit 546446e36e7e68b527767d6c31ec341a49df2059 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Feb 14 16:26:23 2023 -0500 Fix running plots in parallel (#286) The reason the plots were running slower before this change is because I was calling the plot function, not passing it to `submit`. So it was essentially running in serial, but worse because it was still spinning up/down the processes. Co-authored-by: Cole Lyman <cole@colelyman.com> commit d75f32a2eb5aeaaee866c09e5655a3e27af8b1a1 Author: kclem <k.clement.dev@gmail.com> Date: Fri Feb 10 15:45:15 2023 -0500 Fix #283 to avoid filename collisions Previously, amplicon names longer than 21bp were truncated, but the check for uniqueness wasn't working, so it would overwrite some plot files. This fixes the filename collision and enforces uniqueness in reference filename prefixes. Thanks @mbiokyle29 commit e577318006cd17b2725bd028e5e56634c6eb829a Author: kclem <k.clement.dev@gmail.com> Date: Mon Feb 6 16:37:25 2023 -0500 Case-insensitive headers accepted in CRISPRessoPooled commit d34927620a4a6126a9988b3041e76f60728abbfe Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Jan 31 13:48:33 2023 -0500 Fix print statement in CORE commit ee88b7ed89c395f68225a50dea44a2ad69d5e9a5 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Jan 31 13:22:51 2023 -0500 Version bump to 2.2.12 commit 1d4679c72d0c8b4154317c9aff5179217198e2d7 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Jan 31 13:01:31 2023 -0500 Status Updates + Pooled Mixed Mode Update (#279) * Implement logging handler to overwrite the latest log status to file * Add StatusHandler to CRISPRessoCORE log This will take the latest log output and write it to a file (`status.txt`), the catch being that with each log the file is overwritten so that one can easily tell where CRISPResso currently is and what the error is (if any). These changes include some slight refactoring in order to accomodate any potential parameter exceptions. * Add StatusHandler to CRISPRessoBatch and refactor `logger.warn` to `warn` * Add StatusHandler to CRISPRessoPooled and a little refactoring * Implement `percent_complete` to the status log * Add StatusHandler to CRISPRessoAggregate log * Add StatusHandler to CRISPRessoCompare log * Add StatusHandler to CRISPRessoPooledWGSCompare log * Add StatusHandler to CRISPRessoWGS log * Rename `status.txt` to `CRISPResso_status.txt` * Modify status log names to match the tool they are generated from * Add percent_complete stages to CRISPRessoCORE These also include log statements of each plot that is being generated as well as fixing some variable name collisions with `ind`. * Format the percentage in the log to be 2 decimal places * Change all plotting logs from `info` to `debug` and simplify progress This refactors how the progress of the plots is calculated, making it much simplier. Before this change we would of had to keep track of the number of times `percent_complete` was output, but now it simply updates the percent complete after each amplicon is finished processing. Hopefully this will make things easier to mantain even though it will be a little less "accurate" (not sure how accurate the original implementation was...). * Implemented shared console log handler across all CRISPResso* calls This allows for easy changes to logging formatting, which was inspired by having to change the default logging level. The default logging level needs to be set at `logging.DEBUG` in order for the debug log statements to not be ignored for the running and status logs. * Add ability to set the verbosity level to each CRISPResso* tool This allows users to set a verbosity level between 1 and 4 using the `-v`/`--verbosity` CLI parameter. If the `--debug` flag is present, then the level will default to 4, being the most verbose. * Implement showing the last seen `percent_compelte` when none is provided * Keep track of and log when multiple parallel runs are completed These changes modify `CRISPRessoMultiProcessing.run_crispresso_cmds` such that we can now display when a run is completed. This potentially breaks how signals and interupts are handled with multiple runs happening, but this needs to be reviewed. * Add debug and percentage complete to CRISPRessoBatch * Add percent complete to CRISPRessoPooled * Add debug and percent_complete message to CRISPRessoAggregate * Add `percent_complete` to CRISPRessoCompare * Add `percent_complete` to CRISPRessoPooledWGSCompare * Add status and `percent_complete` to CRISPRessoMeta * Add `verbosity` arguments to CRISPRessoCompare and CRISPRessoPooledWGSCompare * Fixing documentation to match pooled headers * Header removal bug fix change documentation to guide_seq * Update documentation and help feature for CRISPRessoPooled * Remove extra newlines from CRISPRessoPooled -h * Make variable names as clear as my firstborn child's name * Update one more variable name * Fix bug to flow CRISPRessoPooled options to sub command * Make amplicon file args variable name clear * Update how parameters are set and retrieved from parameter object The refactor in the previous commit changed the type of the arguments to a dictionary which doesn't have the parameters as attributes, and this commit fixes that error. * Add note in output header for change in default CRISPRessoPooled In the next release (2.3.0) the `--demultiplex_only_at_amplicons` will be the default when running in mixed-mode. This is to allow for inexact alignments of the reads and the amplicons to the genome. For more context, see this issue https://github.com/pinellolab/CRISPResso2/issues/276 * Clarify the verbosity parameter help message * Separate out parameters to `normalize_name` in CRISPRessoCORE * Separate out parameters to `normalize_name` in CRISPRessoWGS * Separate out parameters to `normalize_name` in CRISPRessoPooled * Separate out parameters to `normalize_name` in CRISPRessoCompare * Fix bug in CRISPRessoPooled by replacing `database_id` with `normalize_name` * Refactor `run_crispresso_cmds` to not require a `logger` This commit implements the functionality to make the `logger` object optional by seeing which module called the `run_crispresso_cmds` function and obtaining the correct object from that module name. The function also immediately returns when no commands are passed to it. * Add amplicon name to plotting debug statements in CRISPRessoCORE --------- Co-authored-by: Cole Lyman <cole@coles-mbp-2.lan> Co-authored-by: Cole Lyman <cole@Coles-MacBook-Pro-2.local> Co-authored-by: Cole Lyman <cole@colelyman.com> Co-authored-by: Samuel Nichols <Snic9004@gmail.com> commit ff7eca76e6a3a08af4ac18ac4e88d20f2a06b1f9 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jan 26 15:27:27 2023 -0500 CRISPRessoPooled custom header fix (#278) * Fixing documentation to match pooled headers * Header removal bug fix change documentation to guide_seq * Update documentation and help feature for CRISPRessoPooled * Remove extra newlines from CRISPRessoPooled -h * Make variable names as clear as my firstborn child's name * Update one more variable name Co-authored-by: Samuel Nichols <Snic9004@gmail.com> commit 104866e1080c973bb025d1a5ba59b19dca1658af Author: Cole Lyman <Cole@colelyman.com> Date: Thu Jan 5 14:00:26 2023 -0700 Fix deprecated numpy type names (fixes #269) (#270) In the most recent version of numpy (1.24) some of the types have been deprecated. This commit fixes these errors. commit 58a8e42df88b66fad6b4f6ad04a5b9d9d43d01b4 Author: Cole Lyman <Cole@colelyman.com> Date: Thu Jan 5 06:49:35 2023 -0700 Add snippet about installing CRISPResso2 via bioconda on Apple silicon (#274) I have suffered enough trying to debug my installation, so hopefully this helps someone else. Co-authored-by: Cole Lyman <cole@coles-mbp-2.lan> commit b9851e98104602eb78c2b384105267624295e9d3 Author: Cole Lyman <Cole@colelyman.com> Date: Thu Dec 22 13:30:23 2022 -0700 Fix bug when pooled bam is input (#265) This change checks to see if a bam file was input, and if so it doesn't try to remove any intermediate files because there aren't any. Co-authored-by: Cole Lyman <cole@coles-mbp-2.lan> commit b822612642043e75a19042941f69b457ce51f517 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Dec 19 15:26:45 2022 -0500 Delete vscode settings commit b99aa624dec68ef7d19264340ce0cafa829625f4 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Dec 19 13:29:14 2022 -0500 Clarify input param help for pooled bam commit 3fae1e8b821ec6b1890bff6561fa8fa67dc49a04 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Dec 19 13:28:54 2022 -0500 Fix #235 - Cigar string is * if read unaligned Previously, the bam would set the cigar string to 0 if the read was unaligned. This breaks the sam->bam conversion and causes the errors in #235. commit c65ba07dc5a983453cdf7bb1e27005230dac6f1b Author: Cole Lyman <Cole@colelyman.com> Date: Thu Dec 8 13:48:17 2022 -0700 Add deprecation notice (#260) * Add FLASh and Trimmomatic deprecation notice to CLI output * Add Edilytics email address to CLI output commit 2a30e5a45f5350ee7c6435bce1cd4edc4d31668a Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Dec 6 12:16:19 2022 -0500 Format filterReadsOnSequencePresence script commit 9d764414edd88a46ad5e4f496e4f1c8d5d60ce3e Author: Kendell Clement <k.clement.dev@gmail.com> Date: Fri Dec 2 22:12:54 2022 -0500 Clarify default CRISPRessoPooled settings for use_legacy_bowtie2_options_string commit 9ddea40f7f02b546941ddaa4c71fc5283075051a Author: kclem <k.clement.dev@gmail.com> Date: Mon Nov 14 10:33:04 2022 -0500 Add check for prime editing extension sequence in prime edited sequence if the user specifies the prime_editing_override_prime_edited_ref_seq, it could not contain the extension seq (if they don't provide the extension seq in the appropriate orientation), so check that here. Extension sequence should be provided reverse-complement to the prime edited sequence. commit 152f2dd5001da7090641ee8a1326bde9f7e8104e Author: kclem <k.clement.dev@gmail.com> Date: Wed Nov 9 11:53:41 2022 -0500 Version bump to 2.2.11a commit 9ed356e3a0c6c316d0860d121772f80ddca6de1d Author: kclem <k.clement.dev@gmail.com> Date: Wed Nov 9 11:47:30 2022 -0500 Add param to override prime editing sequence checks CRISPResso checks that prime editing guides are provided in the proper orientation (e.g. pegRNA 3'->5', spacer sequence 5'->3') and checks these orientations by alignment. Sometimes, the alignment can be better in the opposite direction, and this parameter allows these checks to be overridden. Otherwise, these checks would halt the program and produce the output 'The prime editing pegRNA spacer sequence appears to be given in the 3\'->5\' order. The prime editing pegRNA spacer sequence (--prime_editing_pegRNA_spacer_seq) must be given in the RNA 5\'->3\' order.' commit 39dd80afb98a22b7edb6f801c363d86bb77eeb5b Author: kclem <k.clement.dev@gmail.com> Date: Wed Nov 9 10:06:51 2022 -0500 Update filterReadsOnSequencePresence.py commit fe55526927e3fb6e17c9a8a6f59c7057bc1e14eb Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Nov 7 22:25:16 2022 -0500 Add script to filter input based on sequence presence commit 713e57a19c35180035ca35e11a5820065eda0198 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Oct 18 16:02:26 2022 -0400 Allow spaces in read names for CRISPRessoWGS commit 39ce008bdddccdd8229c0ba185dce78bc2f66968 Author: Cole Lyman <Cole@colelyman.com> Date: Sat Oct 8 21:09:58 2022 -0600 Fix typo of CRISPResssoPlot when plotting nucleotide quilt (#250) commit 6a2b342c8503b7327c0a2414edfbd16912d60ca5 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sat Oct 8 23:08:47 2022 -0400 Batch amplicon plots (#251) * Error out if HDR amplicon matches existing amplicon * Add check for amplicon sequence uniqueness * Fix bug with bam_input not having bam_output * Test for no returned lines in auto mode, version bump to 2.2.11 * Fix pandas deprecation of df.append commit 726b2b93d6e419a1b0aa6a968c97edc55b4cc5a8 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Oct 6 16:32:02 2022 -0400 Fix CRISPRessoBatch plot pool bug when plots are suppressed commit 7e5049c4dfb88cbc87c91935a91d1f51120a10c2 Author: Cole Lyman <Cole@colelyman.com> Date: Wed Sep 21 21:04:51 2022 -0600 Fix batch quilt plot name (#249) This fixes an incorrectly named allele quilt plot input in CRISPRessoBatch. commit 1821ca5029c5a1485733f13ab3f2048b4f1fa04e Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Sep 15 15:49:08 2022 -0400 Version bump to 2.2.10 commit c5f79aebfc1ae209f4ee320df250eed89a02787c Author: Cole Lyman <Cole@colelyman.com> Date: Wed Sep 14 14:24:55 2022 -0600 Parallel plot refactor (#247) * Fix duplicate plotting in CRISPRessoBatch aggregate * Refactor mulltiprocessing plots in CRISPRessoBatch * Refactor multiprocessing plots in CRISPRessoCORE * Refactor multiprocessing plots for CRISPRessoAggregate commit 4ed5e24e6cc1dd8068e2391573ae2438acd32db2 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Sep 13 14:12:11 2022 -0400 print files in curr dir if Aggregate can't find files commit ce25bc06f29988e7a10afd0b6a09ba0caf0950e0 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Sep 12 10:32:57 2022 -0400 Spelling typo commit c15f01c75083403f17c58c121b2afe97e9f2a1ec Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Sep 6 17:49:52 2022 -0400 Add helper function to create alignment scoring matrix New scoring matrix can be created using CRISPResso2Align.make_matrix() commit c80f82838c5a228b79ad4484092877cfee08e02c Author: Cole Lyman <Cole@colelyman.com> Date: Mon Aug 22 18:28:33 2022 -0600 Add `zip_output` (#240) * Making zip of results * Zip command added, if zip is true place_report_in_output_folder is also true, zip removes all files while zipping * Adding --zip to compare and pooled/wgs compare * Add more formatting changes to CRISPRessoShared * Refactoring propagate_crispress_options so only one version exists * Zip added to arguments_to_ignore and warning added when changing arguments * Restore styling * Update README to include --zip * Rename --zip to --zip_output * Change --zip to --zip_output in CompareCORE and PooledWGSCompareCORE * Bug fix arg to args Co-authored-by: Samuel Nichols <Snic9004@gmail.com> commit 5de3d7286d8e33c7cf4d3615fce715806e72f511 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Aug 11 21:42:34 2022 -0400 Fix fix to aggregate for CRISPRessoWGS commit a2294c266f43b14969a5d6474076f31a77a57173 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Aug 11 21:40:50 2022 -0400 Fix bug in aggregate for WGS commit 7ce3eb4abe4b8ceac933272ac9cb16a8bedf26a3 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon Aug 8 21:53:45 2022 -0400 Update CRISPRessoWGS to allow non-word characters in region names commit 040ac0033d6e250f4e3a412101874cf5e914e08a Author: kclem <k.clement.dev@gmail.com> Date: Mon Aug 8 16:04:59 2022 -0400 Enable processing of cram files by CRISPRessoWGS Adds --reference to samtools view when viewing cram files commit cf112a0caba8789e28530cc09171285ec6ea9b4c Author: kclem <k.clement.dev@gmail.com> Date: Mon Aug 8 14:55:46 2022 -0400 Auto amplicon detection for interleaved input Enables processing of interleaved fastq files for guess_guides and guess_amplicons, as well as get_most_frequent_reads. When interleaved input is present, the input is first separated into R1/R2 files, then processing is performed. commit 4ba524dc7b947feca8a0f743837844f9febc2171 Author: Cole Lyman <Cole@colelyman.com> Date: Thu Aug 4 11:32:11 2022 -0600 Potential fix for aggregate plots in Batch mode (#237) commit 6097a8a104d3f156ef7c08e196ac37e32bf04c71 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jul 21 22:45:48 2022 -0400 Fix pct_vectors in crispresso2_info json object commit 65a079d86d6f386793397398f839c46014b54543 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed Jul 20 23:46:37 2022 -0400 Fix more readme spelling bugs commit e817376ecd54cdea1f29e303ca25b9e7d1d38333 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed Jul 20 23:42:23 2022 -0400 Fix bug in readme spelling commit 49740ba1d66ed6d13a9e154b8b17bc8b5186581d Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed Jul 20 16:10:09 2022 -0400 Fix loading of crispresso info from WGS and Pooled commit b68a43271115251b18e8955e285ccc18f549e8cd Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jul 14 14:11:04 2022 -0400 Add plotly to dockerfile commit b0b7d41d697304d0d5fc93e3346c9de1b98ba41d Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jul 14 14:10:00 2022 -0400 Fix #231 Allow N's in bam output (Try 2) commit c460b3e73fd06a230dbac2e37c86b833144ebf94 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jul 14 14:09:10 2022 -0400 Revert "Fix #231 Allow N's in bam output" This reverts commit 2f6ad1dbe05210af9ccc1b1f17783cd212a888d3. commit 2f6ad1dbe05210af9ccc1b1f17783cd212a888d3 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jul 14 13:52:37 2022 -0400 Fix #231 Allow N's in bam output commit 0a2419e518dc9b3520058c3927f98b31cd51347e Author: Cole Lyman <Cole@colelyman.com> Date: Fri Jul 8 21:10:01 2022 -0600 Fix bug when name is provided instead of amplicon_name in pooled input file (#229) Also, raise an exception (instead of incorrectly executing) when there are not enough matched parameters in the pooled input file. commit cb58212379803788c04ca5793baaa760cbbeaa81 Author: Cole Lyman <Cole@colelyman.com> Date: Fri Jul 8 21:09:49 2022 -0600 Fix bug when comparing two samples with the same name. (#228) commit e8a796f5f451409cbafed4404dfba4b6b8a124ca Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jun 23 21:30:23 2022 -0400 Version bump to 2.2.9 commit 632143ddedea48bab9229baeb4bf3ea4d1f658d6 Author: Cole Lyman <Cole@colelyman.com> Date: Mon Jun 20 19:53:14 2022 -0600 Don't run global frameshift plot when there are no reads (#226) When there are no reads (i.e. global_MODIFIED_FRAMESHIFT + global_MODIFIED_NON_FRAMESHIFT + global_NON_MODIFIED_NON_FRAMESHIFT == 0) there was a bug when trying to compute the pie chart, because all of the values in the pie chart are 0. This fix, will make sure that there is at least one read in order for the plot to bee constructed properly. commit 4bb06218e835d2624d53fd401542caef6f8a3a55 Author: kclem <k.clement.dev@gmail.com> Date: Fri Jun 3 16:57:02 2022 -0400 Improvements for guide inference in 'auto' mode In 'auto' mode, a putative guide sequence is selected at the site of maximal editing. If the site of maximal editing happens near the end of the guide (e.g. base 0) many things will break (e.g. quantification windows, etc). This update excludes bases from being used to find the guide using the --exclude_bp_from_left and --exclude_bp_from_right parameters. At default, these parameters are 15bp, so the first and last 15bp would not be selected for the site of maximal editing and thus be the site of a guide sequence. In addition, the site of maximal editing must have 3x the magnitude over the background. commit 9d64de187835b2553ad2b4374d32edab27f83645 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Jun 2 20:22:25 2022 -0400 Update README.md commit 6aafc5387986f5089ba55b68d128343d68052792 Author: Simon P Shen <sshen8@users.noreply.github.com> Date: Tue May 31 17:42:53 2022 -0400 directory in quotes in batch cmd (#222) Add quotes around output folder for folders that have spaces. commit 432f163ac68b9a650d1fd326171aadc505ee87f4 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue May 24 23:38:36 2022 -0400 CRISPRessoBatch fills NA values in batch settings NA values in CRISPRessoBatch are filled with the value from args - either the default value or the value from the command line args (if set) commit 6de774adbad3aa8cd99d07b0ba7692984b356cd4 Author: kclem <k.clement.dev@gmail.com> Date: Mon May 23 14:18:02 2022 -0400 Fix file naming bug for HDR outputs In html file, figures 4e and 4f incorrectly referenced figure 4d. This fixes this bug. commit b88fec0668a4082a12ead3d26582e86d829dd7cc Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sat May 21 00:32:15 2022 -0400 For bam_output, fix bug that wrote unaligned lines twice commit 3564e77ebcdedb4b01cc01dcca18ba3221fac67c Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu May 19 16:32:18 2022 -0400 Update README with CRISPRessoPooled headers and bam_output parameters commit bc08d81f17cb1929d1c37a1773cffcf36fb12fe2 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu May 19 16:11:30 2022 -0400 Add more links to tools commit 006c497a379ecd94b017a883a5db887861e1586a Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu May 19 16:08:14 2022 -0400 Add links to tools commit dc8243373ad00d6bd467fc30c59942596ff0c5d6 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Mon May 16 21:38:06 2022 -0400 fastq_to_bam implementation (#219) commit e88b6833977c6b2768299e0b2e7af623e3a9ae7c Author: Kendell Clement <k.clement.dev@gmail.com> Date: Sun May 8 02:14:13 2022 -0400 Fix bug for when guides don't agree in CRISPRessoAggregate commit 7eb763116a8c60603f1cd654645215767ee8eb52 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu May 5 03:28:21 2022 -0400 Fix bug for case of empty summary plots in report generation commit 0324fa67d14ed945f0c9531d9bcf73ebcf4ca042 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu May 5 03:28:02 2022 -0400 Create report for number of significant bases in CRISPRessoCompare commit e3c9d0026a9ee6732f3ed6bdcf2a824850d7e66a Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 22:43:11 2022 -0400 Update pickle to json in readme and CRISPRessoPooledWGSCompare commit 1553f7977c12bf1091a20ca55b878bccfb739b61 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 18:10:04 2022 -0400 Merge pull request #4 from pinellolab/master (#218) commit bcecbfc047d294e26f381a6668e08cb4db24445c Merge: 15b0e05b bb13e007 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 18:06:37 2022 -0400 Merge branch 'master' into master commit bb13e007738d6e7a4909e01f03daff592f334f36 Merge: af4ab6e8 d0b41483 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 17:59:32 2022 -0400 Merge branch 'master' of https://github.com/edilytics/CRISPResso2 commit 15b0e05b9e03bbec5236e58776ddf9aa2f93180e Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 17:54:52 2022 -0400 2 flexible pooled input (#217) * Batch type coerce and r2 file check * Upgrade tabs for bootstrap5 * Update readme with additional pooled amplicon file headers Co-authored-by: Samuel Nichols <Snic9004@gmail.com> commit d0b41483bee704940ba60c58289f412b04c71659 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 13:43:43 2022 -0400 Update README.md commit ce49fab5301cb73ba0daf6c765e350eb083c76f1 Merge: 5f909713 b913fcb4 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 13:40:30 2022 -0400 Merge pull request #3 from edilytics/2-flexible-pooled-input Add flexibility to CRISPRessoPooled amplicon input by allowing headers. Also, prime editing and quantification window coordinate parameters can be passed to CRISPRessoPooled. commit b913fcb402a8ba3106c3ff7913563a33d8d19fca Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 13:38:25 2022 -0400 Update CRISPRessoPooledCORE.py Replace process to read header, increase flexibility for column order commit 945bf31f16530b7ce25b89095b2c7005bf146117 Merge: 7b8f6788 5f909713 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 12:45:24 2022 -0400 Merge branch 'master' into 2-flexible-pooled-input commit 5f9097133765736a7c2fe3c8e9b730845fed0b70 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 12:23:44 2022 -0400 Version bump to 2.2.8 commit c4a94ce0e06c6ebae13e128fbe6b708e635121c4 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Wed May 4 00:13:17 2022 -0400 Fix summary plot representation for multi reports *fixed old reference to make_multi_report which called old summary plot format * renamed summary_plot to summary_plots to reflect a dict with multiple plots commit 62900e9ae6fa37ce99a04f12a63ed5c912f75042 Author: Cole Lyman <Cole@colelyman.com> Date: Tue May 3 20:47:52 2022 -0600 Large aggregation (#192) * Squashed commit of the following: commit 8564eb03f0d9e62abf4b7528baf5c2ae296be8f9 Merge: f6ef62c 07cc7d8 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Tue Jan 11 16:20:15 2022 -0500 Merge branch 'indel-alignment-fix' of https://github.com/edilytics/CRISPResso2 into indel-alignment-fix commit 07cc7d856ab3fcbbaa5381f17f29568192388887 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:29:59 2021 -0700 Fix bug in `find_indels_substitutions` This bug occurred when there was a deletion at the end of a sequence, and was thus not properly accounted for. commit f6ef62cfdf909adac1b10ea86555cd218f8b2a74 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:29:59 2021 -0700 Fix bug in `find_indels_substitutions` This bug occurred when there was a deletion at the end of a sequence, and was thus not properly accounted for. commit 7212f87f4be60057a6c848947ff6b5efde132a25 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:26:17 2021 -0700 Add a unit test for `find_indels_substitutions` This unit test checks for deletions at the end of a sequence, which are inherently outside of the include_indx_set window. commit d50b4e903b973c71a275e31d470b40e59280ee13 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:03:22 2021 -0700 Fix a bug in `find_indels_substitutions` The bug that this commit fixes is when an insertion occurs at the edge of the include indexes. The trouble with this earlier was that it was using the `idx` to calculate the size of the insertion, but the `idx` wasn't being incremented anymore because it was outside of the include window. commit 4db066f7bc333b7662a9232ac732ebb33ac3ace8 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:01:39 2021 -0700 Add test case for `find_indels_substitutions` This test case is extracted from the CRISPRessoBatch integration test and provides an example where there is an insertion at the edge of the include index. commit 3b3a7417f5bbd6c2785a2af54a47e01d2e820451 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 11:37:07 2021 -0700 Fix bug in CRISPRessoCompare where sample names were not properly set This was a place where it was (partially) missed during the crispresso2_info object refactoring. commit e9f5eff3d95b676b5ee2e23371a5604f600d34b2 Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:26:17 2021 -0700 Add a unit test for `find_indels_substitutions` This unit test checks for deletions at the end of a sequence, which are inherently outside of the include_indx_set window. commit d4d45a918254ab19a7e7956e9e731389c6f36ecb Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:03:22 2021 -0700 Fix a bug in `find_indels_substitutions` The bug that this commit fixes is when an insertion occurs at the edge of the include indexes. The trouble with this earlier was that it was using the `idx` to calculate the size of the insertion, but the `idx` wasn't being incremented anymore because it was outside of the include window. commit 13f00bb40239c83e6e5cf844561fdb7000d3d9ab Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 15:01:39 2021 -0700 Add test case for `find_indels_substitutions` This test case is extracted from the CRISPRessoBatch integration test and provides an example where there is an insertion at the edge of the include index. commit 659ae34e8fd106f7ecc163b5bea0b5a80ab0283c Author: Cole Lyman <cole@colelyman.com> Date: Fri Dec 10 11:37:07 2021 -0700 Fix bug in CRISPRessoCompare where sample names were not properly set This was a place where it was (partially) missed during the crispresso2_info object refactoring. * Add parameter `--suppress_batch_summary_plots` If many runs are run at the same time, batch summary plots may fail because they are too large for matplotlib. This parameter `--suppress_batch_summary_plots` allows individual runs to be plotted, but suppresses batch summary plots that may otherwise be too big. * Pep formatting cleanup * Add summary nucleotide plots to aggregate * Aggregate plots are paginated * Update CRISPRessoAggregateCORE.py Remove max sample limit for plotting * Add --max_samples_per_summary_plot to CRISPRessoAggregate Parameterize the max number of samples to plot on each page of reports. Additional PDFs will be created with this number of samples on them. * Add plotly function to plot an interactive heatmap * Fix deprecated numpy type to suppress warning * Add plotting of heatmaps to CRISPRessoAggregateCORE to summarize modification types These heatmaps are interactive (zoomable and panable) and show for each sample the percentage of insertions, substitutions, and deletions. * Add the heatmap summaries to the CRISPRessoAggregate report * Update Bootstrap to 5.1.3 This is mainly so that we can use the fullscreen modal functionality in this version. * Move the plotly heatmaps to a Bootstrap modal * Fix bug where plots were not filling up entire modal. I have tried countless different ways for this to work, and this is the best that I can come up with. After the modal is opened it triggers the plot to resize, and then for some reason you need to trigger the resize event. I think this is because a `div` changing size won't actually trigger the resizing of the plot (and neither will just calling `Plotly.Plots.resize`...?!). * Update the axis labels and add autosize to plotly heatmaps I'm pretty sure the autosize doesn't do anything, but it is there for good measure. * Abandon attempts to make plots fullscreen This includes removing the Bootstrap modal (two out of the three plots would resize properly and I couldn't figure out a way to have the plot displayed outside of the modal). I have left in some javascript to make the plot fullscreen, but I couldn't get the formatting quite right and the plot wasn't much bigger in the fullscreen version because there was a ton of space between the plot and the heatmap. If some brave soul would like to tackle it, feel free! * Rename and refactor how plot data is passed around I have consolidated how the plot data is passed around, so that now you can pass in only one dict with all of the information instead of 4 or 5 separate parameters. I also renamed the `heatmap_plot_*` to `allele_modification_heatmap_*`. * Implement the line plot version of the modification percentages This also includes correctly resizing the plot when the line plot tab is selected! * Change default `max_samples_per_summary_plot` to be 150 instead of 250 * Remove extra assignments of `this_number_samples` and suppress plot The plot that is suppressed is the large nucleotide quilt when there is a large number of samples. Is it okay to suppress this plot @kclem? * Implement parallel plotting in CRISPRessoAggregate * Fix sample indexing error and heatmap scaling for large number of samples * Add parameter `--suppress_batch_summary_plots` If many runs are run at the same time, batch summary plots may fail because they are too large for matplotlib. This parameter `--suppress_batch_summary_plots` allows individual runs to be plotted, but suppresses batch summary plots that may otherwise be too big. * Pep formatting cleanup * Add summary nucleotide plots to aggregate * Aggregate plots are paginated * Update CRISPRessoAggregateCORE.py Remove max sample limit for plotting * Add --max_samples_per_summary_plot to CRISPRessoAggregate Parameterize the max number of samples to plot on each page of reports. Additional PDFs will be created with this number of samples on them. * Add plotly function to plot an interactive heatmap * Fix deprecated numpy type to suppress warning * Add plotting of heatmaps to CRISPRessoAggregateCORE to summarize modification types These heatmaps are interactive (zoomable and panable) and show for each sample the percentage of insertions, substitutions, and deletions. * Add the heatmap summaries to the CRISPRessoAggregate report * Update Bootstrap to 5.1.3 This is mainly so that we can use the fullscreen modal functionality in this version. * Move the plotly heatmaps to a Bootstrap modal * Fix bug where plots were not filling up entire modal. I have tried countless different ways for this to work, and this is the best that I can come up with. After the modal is opened it triggers the plot to resize, and then for some reason you need to trigger the resize event. I think this is because a `div` changing size won't actually trigger the resizing of the plot (and neither will just calling `Plotly.Plots.resize`...?!). * Update the axis labels and add autosize to plotly heatmaps I'm pretty sure the autosize doesn't do anything, but it is there for good measure. * Abandon attempts to make plots fullscreen This includes removing the Bootstrap modal (two out of the three plots would resize properly and I couldn't figure out a way to have the plot displayed outside of the modal). I have left in some javascript to make the plot fullscreen, but I couldn't get the formatting quite right and the plot wasn't much bigger in the fullscreen version because there was a ton of space between the plot and the heatmap. If some brave soul would like to tackle it, feel free! * Rename and refactor how plot data is passed around I have consolidated how the plot data is passed around, so that now you can pass in only one dict with all of the information instead of 4 or 5 separate parameters. I also renamed the `heatmap_plot_*` to `allele_modification_heatmap_*`. * Implement the line plot version of the modification percentages This also includes correctly resizing the plot when the line plot tab is selected! * Change default `max_samples_per_summary_plot` to be 150 instead of 250 * Remove extra assignments of `this_number_samples` and suppress plot The plot that is suppressed is the large nucleotide quilt when there is a large number of samples. Is it okay to suppress this plot @kclem? * Implement parallel plotting in CRISPRessoAggregate * Fix sample indexing error and heatmap scaling for large number of samples * Add plotly requrement to setup.py * Remove space around vertical barcharts * Add scrollbar to long images in multiReport * Fill in default (empty) values to allele modification plots When not running CRISPRessoAggregate, default values for the `allele_modification_heatmap_plot` and `allele_modification_lin_plot` dictionaries will be set so that the template can be properly rendered. * Include CRISPRessoBatch in the refactor of how summary_plot dicts are handled * Update dockerfile for new docker * minor bug fixes for plotCustomAllelePlot.py to work with Python3 (#212) * Allow for flexible parsing of quant window coordinates * CRISPRessoPooled debug flash command, fix pep formatting * Set flexiguide homology parameter type to int * Coerce ints in batch file checking (#200) * Batch type coerce and r2 file check * Revert "Batch type coerce and r2 file check" This reverts commit f91736688ea9739cf3063e3601c52ad6da1116a4. * Coerce int values * Handle multiple qwcs in batch mode If multiple qwcs were provided in batch mode, a parsing error would occur. This fixes this bug. * Fix bug from old pandas for int cols Evidently old pandas versions throw an error if a column doesn't exist. This checks to see if the column exists before the values are set. * Create allele modification heatmaps and line plots in CRISPRessoBatch * Add allele modification heatmaps and line plots to CRISPRessoBatch * Make all plots in CRISPRessoBatch run in parallel * Make `--suppress_batch_summary_plots` store true Also, only open and shutdown the process pool when necessary. * Add blank values for allele_modification entries when not present Co-authored-by: Kendell Clement <k.clement.dev@gmail.com> Co-authored-by: dharjanto <dewi.harjanto@gmail.com> Co-authored-by: Samuel Nichols <Snic9004@gmail.com> commit f67376fc9ab0e407d4086aa42fd1c77706ebc9c0 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Fri Apr 15 00:46:30 2022 -0400 Fix bug from old pandas for int cols Evidently old pandas versions throw an error if a column doesn't exist. This checks to see if the column exists before the values are set. commit b34fe2956ff88629809b2434878028723dfc4895 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Apr 14 23:58:07 2022 -0400 Handle multiple qwcs in batch mode If multiple qwcs were provided in batch mode, a parsing error would occur. This fixes this bug. commit c94e3b9f2e301bda91e9c1e6f4ef794b33b5dbf0 Author: Samuel Nichols <Snic9004@gmail.com> Date: Thu Apr 14 21:48:32 2022 -0600 Coerce ints in batch file checking (#200) * Batch type coerce and r2 file check * Revert "Batch type coerce and r2 file check" This reverts commit f91736688ea9739cf3063e3601c52ad6da1116a4. * Coerce int values commit fc4542491bb86eb143db0044a848a56234403496 Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Apr 14 22:13:23 2022 -0400 Set flexiguide homology parameter type to int commit 23fe2aa8e26067d1bcf36bfafc67e023c7588d2f Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Apr 14 22:12:37 2022 -0400 CRISPRessoPooled debug flash command, fix pep formatting commit d292d33d8c1fa3bfd2cee656643fd47bcdab161d Author: Kendell Clement <k.clement.dev@gmail.com> Date: Thu Apr 14 22:00:19 2022 -0400 Allow for flexible parsing of quant window coordinates commit e1667cb53a7ea6fbb33369c8530a78639ed423ec Author: dharjanto <dewi.harjanto@gmail.com> Date: Mon Apr 11 22:08:21 2022 -0400 minor bug fixes for plotCustomAllelePlot.py to work with Python3 (#212) commit 7b8f6788da18f6ab173fa3c3d10f4ab6bb2acc26 Author: Samuel Nichols <Snic9004@gmail.com> Date: Fri Apr 8 10:21:00 2022 -0600 Update README commit 9bc24cd0474ed9f398dff64274d3181c4b2f8637 Author: Samuel Nichols <Snic9004@gmail.com> Date: Tue Mar 29 11:25:09 2022 -0600 Using Amplicon_Name commit 88ac5d72074b3da63de035e02c911ce34cd29414 Merge: b6057a2d e5afa478 Author: Samuel Nichols <Snic9004@gmail.com> Date: Mon Mar 28 22:32:09 2022 -0600 Merge remote-tracking branch 'origin/master' into 2-flexible-pooled-input commit b6057a2d54cb8637ff0900416de8e2de72213f76 Author: Samuel Nichols <Snic9004@gmail.com> Date: Mon Mar 28 20:53:05 2022 -0600 Printing info statements for matched headers commit af4ab6e8507d7aa4b7b68f217a458e0d9c966f55 Merge: bbb7d6f0 51a943c3 Author: Cole Lyman <Cole@colelyman.com> Date: Fri Mar 25 09:44:13 2022 -0600 Merge branch 'pinellolab:master' into master commit 3c1eb012fc02563e3e963f17a62c7e932f5bcddc Author: Samuel Nichols <Snic9004@gmail.com> Date: Thu Mar 24 12:31:43 2022 -0600 Debugging and column checking commit 0b47acbc592a6df6adf14641357b2104b76be691 Author: Samuel Nichols <Snic9004@gmail.com> Date: Wed Mar 23 09:42:51 2022 -0600 New variables added to pooled commit a0ff3a44d6d19d7b37f91919b5c0180206f72d53 Author: Samuel Nichols <Snic9004@gmail.com> Date: Mon Mar 21 09:32:28 2022 -0600 Read as string not bytes commit 710675fc3c0307e21103abd604315b47ff80a894 Author: Samuel Nichols <Snic9004@gmail.com> Date: Wed Mar 16 13:51:30 2022 -0600 Adding command building for new options commit f386818a48e5c840bd567611e6f1320c8146cac7 Author: Samuel Nichols <Snic9004@gmail.com> Date: Wed Mar 16 10:08:33 2022 -0600 Comment out df_template.iloc instance commi…
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment
Add this suggestion to a batch that can be applied as a single commit.
This suggestion is invalid because no changes were made to the code.
Suggestions cannot be applied while the pull request is closed.
Suggestions cannot be applied while viewing a subset of changes.
Only one suggestion per line can be applied in a batch.
Add this suggestion to a batch that can be applied as a single commit.
Applying suggestions on deleted lines is not supported.
You must change the existing code in this line in order to create a valid suggestion.
Outdated suggestions cannot be applied.
This suggestion has been applied or marked resolved.
Suggestions cannot be applied from pending reviews.
Suggestions cannot be applied on multi-line comments.
Suggestions cannot be applied while the pull request is queued to merge.
Suggestion cannot be applied right now. Please check back later.