Release version 2.6.1

release 2.6.1 2022-01-26 ===============================================
This release fixes a small memory bug.

release 2.6.0 2022-01-08 ===============================================
This release adds new features to primer3_core and related C code.

The actual annealing temperature of the PCR reaction may be specified by PRIMER_ANNEALING_TEMP. The Primer3 calculates the fraction of primer bound and provides PRIMER_[LEFT/INTERNAL/RIGHT]_4_BOUND as percent value in the output. Primers may also be selected on a given fraction range please see "GENERAL THOUGHTS ON PRIMER BINDING" in primer3_manual.htm for details.

SEQUENCE_OVERHANG_LEFT and SEQUENCE_OVERHANG_RIGHT may specify a sequence which is added to the 5' end of the respective primer. The overhang sequences are utilized in calculating SELF_ANY, SELF_END, HAIRPIN, COMPL_ANY, COMPL_END, plus the _TH and _STRUCT versions of those outputs, as well as PRODUCT_SIZE. Internal oligos may not have an overhang. The length of SEQUENCE_OVERHANG_LEFT and SEQUENCE_OVERHANG_RIGHT do not add to the binding product size of PRIMER_PRODUCT_SIZE_RANGE or PRIMER_PRODUCT_OPT_SIZE. The TM and GC_PERCENT calculations will only be based on the 3' portion of the oligo that binds to the template.

The selection of internal/middle oligos/probes was enhanced for exact positioning in the light of SNP analysis. The SEQUENCE_EXCLUDED_REGION (were no left/right primers may bind, bud middle probes) and SEQUENCE_INTERNAL_EXCLUDED_REGION (were no middle probes may bind, but left/right primers) was left unmodified. In addition a SEQUENCE_INTERNAL_OVERLAP_JUNCTION_LIST of positions a middle probes has to overlap may be provided. A distance to the ends of the middle probe is set by RIMER_INTERNAL_MIN_5_PRIME_OVERLAP_OF_JUNCTION and PRIMER_INTERNAL_MIN_3_PRIME_OVERLAP_OF_JUNCTION. The number of returned middle probes at one location may be limited by PRIMER_INTERNAL_MIN_THREE_PRIME_DISTANCE. See the test primer_internal_position_input for example use.

Primer3 includes corrections for DMSO using PRIMER_DMSO_CONC and formamide using PRIMER_FORMAMIDE_CONC. Only he calculated Tm of primers, oligos and the product Tm will be corrected.

Amplicon3 was included as a new tool in the Primer3 package and calculates melting curves of PCR products. Amplicon3 is based on MeltPolymer.c from the DECIPHER package created by Erik Wright and is licensed under GPL-3. Currently it only supports SantaLucia thermodynamic parameters and salt correction. Please consider Amplicon3 experimental.

Minor fixes:

1. Handling of N in PRIMER_MAX_POLY_X was fixed. Now 'GGGNNN' violates MAX_POLY_X=5. It is now based on the worst possible case (all 3 Ns could be Gs).
2. ntthal allows multiple queries using the -i command line option. ntthal runs in an interactive mode, each line is an oligo, where pairs of consecutive lines are pairs of oligos to test (only for dimers).
3. GitHub default branch was renamed to main. Please run these commands on old repos:
   git branch -m master main
   git fetch origin
   git branch -u origin/main main
   git remote set-head origin -a
4. Provided left and right primer may be not identical or the reverse complement of each other.
5. More informative primer statistics with PRIMER_TASK=pick_sequencing_primers.
6. PRIMER_PAIR_4_PRODUCT_TM is now always provided.
7. SEQUENCE_START_CODON_SEQUENCE allows to specify an alternative start codon to be used with SEQUENCE_START_CODON_POSITION.

Release version 2.6.0

release 2.6.0 2022-01-08 ===============================================
This release adds new features to primer3_core and related C code.

The actual annealing temperature of the PCR reaction may be specified by PRIMER_ANNEALING_TEMP. The Primer3 calculates the fraction of primer bound and provides PRIMER_[LEFT/INTERNAL/RIGHT]_4_BOUND as percent value in the output. Primers may also be selected on a given fraction range please see "GENERAL THOUGHTS ON PRIMER BINDING" in primer3_manual.htm for details.

SEQUENCE_OVERHANG_LEFT and SEQUENCE_OVERHANG_RIGHT may specify a sequence which is added to the 5' end of the respective primer. The overhang sequences are utilized in calculating SELF_ANY, SELF_END, HAIRPIN, COMPL_ANY, COMPL_END, plus the _TH and _STRUCT versions of those outputs, as well as PRODUCT_SIZE. Internal oligos may not have an overhang. The length of SEQUENCE_OVERHANG_LEFT and SEQUENCE_OVERHANG_RIGHT do not add to the binding product size of PRIMER_PRODUCT_SIZE_RANGE or PRIMER_PRODUCT_OPT_SIZE. The TM and GC_PERCENT calculations will only be based on the 3' portion of the oligo that binds to the template.

The selection of internal/middle oligos/probes was enhanced for exact positioning in the light of SNP analysis. The SEQUENCE_EXCLUDED_REGION (were no left/right primers may bind, bud middle probes) and SEQUENCE_INTERNAL_EXCLUDED_REGION (were no middle probes may bind, but left/right primers) was left unmodified. In addition a SEQUENCE_INTERNAL_OVERLAP_JUNCTION_LIST of positions a middle probes has to overlap may be provided. A distance to the ends of the middle probe is set by RIMER_INTERNAL_MIN_5_PRIME_OVERLAP_OF_JUNCTION and PRIMER_INTERNAL_MIN_3_PRIME_OVERLAP_OF_JUNCTION. The number of returned middle probes at one location may be limited by PRIMER_INTERNAL_MIN_THREE_PRIME_DISTANCE. See the test primer_internal_position_input for example use.

Primer3 includes corrections for DMSO using PRIMER_DMSO_CONC and formamide using PRIMER_FORMAMIDE_CONC. Only he calculated Tm of primers, oligos and the product Tm will be corrected.

Amplicon3 was included as a new tool in the Primer3 package and calculates melting curves of PCR products. Amplicon3 is based on MeltPolymer.c from the DECIPHER package created by Erik Wright and is licensed under GPL-3. Currently it only supports SantaLucia thermodynamic parameters and salt correction. Please consider Amplicon3 experimental.

Minor fixes:

1. Handling of N in PRIMER_MAX_POLY_X was fixed. Now 'GGGNNN' violates MAX_POLY_X=5. It is now based on the worst possible case (all 3 Ns could be Gs).
2. ntthal allows multiple queries using the -i command line option. ntthal runs in an interactive mode, each line is an oligo, where pairs of consecutive lines are pairs of oligos to test (only for dimers).
3. GitHub default branch was renamed to main. Please run these commands on old repos:
   git branch -m master main
   git fetch origin
   git branch -u origin/main main
   git remote set-head origin -a
4. Provided left and right primer may be not identical or the reverse complement of each other.
5. More informative primer statistics with PRIMER_TASK=pick_sequencing_primers.
6. PRIMER_PAIR_4_PRODUCT_TM is now always provided.
7. SEQUENCE_START_CODON_SEQUENCE allows to specify an alternative start codon to be used with SEQUENCE_START_CODON_POSITION.

Release version 2.5.0

release 2.5.0 - 2019-08-17

This release adds new features to primer3_core and related C code.

The primer3_config files for thermodynamic calculations are embedded in the
code and the primer3_config/ folder is not required any more for default
settings.

If PRIMER_SECONDARY_STRUCTURE_ALIGNMENT=1 is set, the secondary structure
will be displayed as string representation (for example):

PRIMER_LEFT_0_SELF_ANY_STUCT=5' ATTCGATTCTCCCCGGTATC 3'\n ||||\n 3' CTATGGCCCCTCTTAGCTTA 5'\n

for the structure:

5' ATTCGATTCTCCCCGGTATC 3'
               ||||
        3' CTATGGCCCCTCTTAGCTTA 5'

Minor fixes:

1. Primer3 can handle windows newlines on input files.

2. A bug in the compl_end calculations was fixed.

3. The primer3_config/ folder is not required any more.