Skip to content

Commit

Permalink
Merge pull request #30 from quick-lab/staging
Browse files Browse the repository at this point in the history
Staging
  • Loading branch information
ChrisgKent committed May 14, 2024
2 parents 5a7d12d + 856335f commit bc97b2f
Show file tree
Hide file tree
Showing 93 changed files with 2,708 additions and 2,296 deletions.
1,413 changes: 706 additions & 707 deletions index.json

Large diffs are not rendered by default.

24 changes: 17 additions & 7 deletions primerschemes/artic-measles/400/v1.0.0/README.md
Original file line number Diff line number Diff line change
@@ -1,5 +1,7 @@
# artic-measles 400bp v1.0.0

[primalscheme labs](https://labs.primalscheme.com/detail/artic-measles/400/v1.0.0)

## Description

A pan Measles morbillivirus scheme. All full length genomes have been downloaded and phylogenicly downsampled to 0.95 RTL.
Expand All @@ -15,8 +17,8 @@ A pan Measles morbillivirus scheme. All full length genomes have been downloaded
"ampliconsize": 400,
"schemeversion": "v1.0.0",
"schemename": "artic-measles",
"primer_bed_md5": "b8b903356d4c6bd4dc03af04f3a18222",
"reference_fasta_md5": "2c3dd74742a333dffb50bcfbd158bfbd",
"primer_bed_md5": "b75c16322b1e1c5e606917b5653c01f1",
"reference_fasta_md5": "64a52bcc7c18986db1c11813db518390",
"status": "tested",
"citations": [],
"authors": [
Expand All @@ -29,16 +31,24 @@ A pan Measles morbillivirus scheme. All full length genomes have been downloaded
],
"license": "CC BY-SA 4.0",
"primerclass": "primerschemes",
"infoschema": "v1.3.0",
"infoschema": "v2.0.0",
"articbedversion": "v3.0",
"description": "A pan Measles morbillivirus scheme. All full length genomes have been downloaded and phylogenicly downsampled to 0.95 RTL.",
"derivedfrom": null,
"collections": [
"WASTE-WATER",
"QUICK-LAB",
"WHOLE-GENOME",
"WASTE-WATER",
"ARTIC"
]
],
"links": {
"protocals": [],
"validation": [],
"homepage": [],
"vendors": [],
"misc": []
},
"description": "A pan Measles morbillivirus scheme. All full length genomes have been downloaded and phylogenicly downsampled to 0.95 RTL.",
"derivedfrom": null,
"contactinfo": null
}
```

Expand Down
22 changes: 15 additions & 7 deletions primerschemes/artic-measles/400/v1.0.0/info.json
Original file line number Diff line number Diff line change
Expand Up @@ -2,8 +2,8 @@
"ampliconsize": 400,
"schemeversion": "v1.0.0",
"schemename": "artic-measles",
"primer_bed_md5": "b8b903356d4c6bd4dc03af04f3a18222",
"reference_fasta_md5": "2c3dd74742a333dffb50bcfbd158bfbd",
"primer_bed_md5": "b75c16322b1e1c5e606917b5653c01f1",
"reference_fasta_md5": "64a52bcc7c18986db1c11813db518390",
"status": "tested",
"citations": [],
"authors": [
Expand All @@ -16,14 +16,22 @@
],
"license": "CC BY-SA 4.0",
"primerclass": "primerschemes",
"infoschema": "v1.3.0",
"infoschema": "v2.0.0",
"articbedversion": "v3.0",
"description": "A pan Measles morbillivirus scheme. All full length genomes have been downloaded and phylogenicly downsampled to 0.95 RTL.",
"derivedfrom": null,
"collections": [
"WASTE-WATER",
"QUICK-LAB",
"WHOLE-GENOME",
"WASTE-WATER",
"ARTIC"
]
],
"links": {
"protocals": [],
"validation": [],
"homepage": [],
"vendors": [],
"misc": []
},
"description": "A pan Measles morbillivirus scheme. All full length genomes have been downloaded and phylogenicly downsampled to 0.95 RTL.",
"derivedfrom": null,
"contactinfo": null
}
2 changes: 1 addition & 1 deletion primerschemes/artic-measles/400/v1.0.0/primer.bed
Original file line number Diff line number Diff line change
Expand Up @@ -372,4 +372,4 @@ NC_001498.1 15858 15888 177e6ebb_46_RIGHT_3 1 - CAAAGCTGGGAATAGAAACTTCGTATTTTC
NC_001498.1 15858 15887 177e6ebb_46_RIGHT_4 1 - CAAAGCTGGGAATAGAACTTCGTATTTTC
NC_001498.1 15858 15887 177e6ebb_46_RIGHT_5 1 - CAAGCTGGGAATAGAAACTTCGTATTTTC
NC_001498.1 15858 15889 177e6ebb_46_RIGHT_6 1 - GACAAACTGGGAATAGAAACTTCGTATTTTC
NC_001498.1 15858 15889 177e6ebb_46_RIGHT_7 1 - GACAAAGTGGGAATAGAAACTTCGTATTTTC
NC_001498.1 15858 15889 177e6ebb_46_RIGHT_7 1 - GACAAAGTGGGAATAGAAACTTCGTATTTTC
2 changes: 1 addition & 1 deletion primerschemes/artic-measles/400/v1.0.0/reference.fasta
Original file line number Diff line number Diff line change
Expand Up @@ -263,4 +263,4 @@ ATCTCAAGTCCGGTTATCTAGTACTAGACTTACACCAGAATATCTTCGTTAAGAATCTAT
CCAAGTCAGAGAAACAGATTATTATGACGGGGGGTTTAAAACGTGAGTGGGTTTTTAAGG
TAACAGTCAAGGAGACCAAAGAATGGTACAAGTTAGTCGGATACAGCGCTCTGATTAAGG
ATTAATTGGTTGAACTCCGGAACCCTAATCCTGCCCTAGGTAGTTAGGCATTATTTGCAA
TATATTAAAGAAAACTTTGAAAATACGAAGTTTCTATTCCCAGCTTTGTCTGGT
TATATTAAAGAAAACTTTGAAAATACGAAGTTTCTATTCCCAGCTTTGTCTGGT
28 changes: 19 additions & 9 deletions primerschemes/artic-pan-ebola/1000/v1.0.0/README.md
Original file line number Diff line number Diff line change
@@ -1,5 +1,7 @@
# artic-pan-ebola 1000bp v1.0.0

[primalscheme labs](https://labs.primalscheme.com/detail/artic-pan-ebola/1000/v1.0.0)

## Overviews

![NC_006432.1.png](work/NC_006432.1.png)
Expand All @@ -11,8 +13,8 @@
"ampliconsize": 1000,
"schemeversion": "v1.0.0",
"schemename": "artic-pan-ebola",
"primer_bed_md5": "c58ec3b4d07d24499106fed6501016a9",
"reference_fasta_md5": "083c89a1798778fbe94a643d83a6fbb1",
"primer_bed_md5": "6b9554c28693b521cfbe2246091c61af",
"reference_fasta_md5": "c5432a6813f9a2604ea5e5e2bb94508e",
"status": "draft",
"citations": [],
"authors": [
Expand All @@ -25,16 +27,24 @@
],
"license": "CC BY-SA 4.0",
"primerclass": "primerschemes",
"infoschema": "v1.3.0",
"infoschema": "v2.0.0",
"articbedversion": "v3.0",
"description": null,
"derivedfrom": null,
"collections": [
"CLINAL-ISOLATES",
"WHOLE-GENOME",
"QUICK-LAB",
"ARTIC"
]
"WHOLE-GENOME",
"ARTIC",
"CLINAL-ISOLATES"
],
"links": {
"protocals": [],
"validation": [],
"homepage": [],
"vendors": [],
"misc": []
},
"description": null,
"derivedfrom": null,
"contactinfo": null
}
```

Expand Down
26 changes: 17 additions & 9 deletions primerschemes/artic-pan-ebola/1000/v1.0.0/info.json
Original file line number Diff line number Diff line change
Expand Up @@ -2,8 +2,8 @@
"ampliconsize": 1000,
"schemeversion": "v1.0.0",
"schemename": "artic-pan-ebola",
"primer_bed_md5": "c58ec3b4d07d24499106fed6501016a9",
"reference_fasta_md5": "083c89a1798778fbe94a643d83a6fbb1",
"primer_bed_md5": "6b9554c28693b521cfbe2246091c61af",
"reference_fasta_md5": "c5432a6813f9a2604ea5e5e2bb94508e",
"status": "draft",
"citations": [],
"authors": [
Expand All @@ -16,14 +16,22 @@
],
"license": "CC BY-SA 4.0",
"primerclass": "primerschemes",
"infoschema": "v1.3.0",
"infoschema": "v2.0.0",
"articbedversion": "v3.0",
"description": null,
"derivedfrom": null,
"collections": [
"CLINAL-ISOLATES",
"WHOLE-GENOME",
"QUICK-LAB",
"ARTIC"
]
"WHOLE-GENOME",
"ARTIC",
"CLINAL-ISOLATES"
],
"links": {
"protocals": [],
"validation": [],
"homepage": [],
"vendors": [],
"misc": []
},
"description": null,
"derivedfrom": null,
"contactinfo": null
}
2 changes: 1 addition & 1 deletion primerschemes/artic-pan-ebola/1000/v1.0.0/primer.bed
Original file line number Diff line number Diff line change
Expand Up @@ -127,4 +127,4 @@ NC_006432.1 17045 17078 81307655_18_LEFT_1 1 + GCCTTACTATTGATCCAGAAATACCAAGTTAAA
NC_006432.1 17045 17078 81307655_18_LEFT_2 1 + GCCTTACTATTGATTCAGAAATACCAAGTTAAG
NC_006432.1 18096 18122 81307655_18_RIGHT_0 1 - CCCTGTCAGCCTTTCAATAAGCTTAA
NC_006432.1 18096 18122 81307655_18_RIGHT_1 1 - CCCTGTCAGCCTTTCGATAAGCTTAA
NC_006432.1 18096 18120 81307655_18_RIGHT_2 1 - TGGTGAGCCGGTCCATAAGTTTTA
NC_006432.1 18096 18120 81307655_18_RIGHT_2 1 - TGGTGAGCCGGTCCATAAGTTTTA
2 changes: 1 addition & 1 deletion primerschemes/artic-pan-ebola/1000/v1.0.0/reference.fasta
Original file line number Diff line number Diff line change
Expand Up @@ -313,4 +313,4 @@ TATACAGCCAAAATATTTCATAGGGCCGATGGGAATAACATAAGAGGAACATGATCAATG
AACCCTTTATTCCAACTAGGCAGTTGATTGATAATCTACAAATTCCATAAGATGTTCTTA
CGATATTCTTTTGTTTTTAATCTCAATGTCAATGATTTAATAAGTAATAATAAAAAAATC
ACATTAAAGATGCAGGAAGATCTTGACCTCGCCAGGAAAATTAAGCGCACACAAATAAAT
TAAAAAATCTGTATTTTCTCTTTTTTGTGTGTCCA
TAAAAAATCTGTATTTTCTCTTTTTTGTGTGTCCA
30 changes: 20 additions & 10 deletions primerschemes/artic-sars-cov-2/400/v1.0.0/README.md
Original file line number Diff line number Diff line change
@@ -1,5 +1,7 @@
# artic-sars-cov-2 400bp v1.0.0

[primalscheme labs](https://labs.primalscheme.com/detail/artic-sars-cov-2/400/v1.0.0)

## Description

Schemes generated for the SARs-CoV-2 Outbreak
Expand All @@ -13,8 +15,8 @@ Schemes generated for the SARs-CoV-2 Outbreak
"ampliconsize": 400,
"schemeversion": "v1.0.0",
"schemename": "artic-sars-cov-2",
"primer_bed_md5": "578f9cb933e01de0f3e9921cec14e5dc",
"reference_fasta_md5": "92ed86bf00cf94f9daef6acc81a8e48e",
"primer_bed_md5": "c79fcfba30e22def02857c8455576a82",
"reference_fasta_md5": "7f8995394dfc7d5ffeb9fe8322ade58c",
"status": "deprecated",
"citations": [
"https://doi.org/10.1038/nprot.2017.066"
Expand All @@ -29,16 +31,24 @@ Schemes generated for the SARs-CoV-2 Outbreak
],
"license": "CC-BY-4.0",
"primerclass": "primerschemes",
"infoschema": "v1.3.0",
"articbedversion": "v2.0",
"description": "Schemes generated for the SARs-CoV-2 Outbreak",
"derivedfrom": null,
"infoschema": "v2.0.0",
"articbedversion": "v3.0",
"collections": [
"WHOLE-GENOME",
"QUICK-LAB",
"ARTIC",
"WASTE-WATER"
]
"WHOLE-GENOME",
"WASTE-WATER",
"ARTIC"
],
"links": {
"protocals": [],
"validation": [],
"homepage": [],
"vendors": [],
"misc": []
},
"description": "Schemes generated for the SARs-CoV-2 Outbreak",
"derivedfrom": null,
"contactinfo": null
}
```

28 changes: 18 additions & 10 deletions primerschemes/artic-sars-cov-2/400/v1.0.0/info.json
Original file line number Diff line number Diff line change
Expand Up @@ -2,8 +2,8 @@
"ampliconsize": 400,
"schemeversion": "v1.0.0",
"schemename": "artic-sars-cov-2",
"primer_bed_md5": "578f9cb933e01de0f3e9921cec14e5dc",
"reference_fasta_md5": "92ed86bf00cf94f9daef6acc81a8e48e",
"primer_bed_md5": "c79fcfba30e22def02857c8455576a82",
"reference_fasta_md5": "7f8995394dfc7d5ffeb9fe8322ade58c",
"status": "deprecated",
"citations": [
"https://doi.org/10.1038/nprot.2017.066"
Expand All @@ -18,14 +18,22 @@
],
"license": "CC-BY-4.0",
"primerclass": "primerschemes",
"infoschema": "v1.3.0",
"articbedversion": "v2.0",
"description": "Schemes generated for the SARs-CoV-2 Outbreak",
"derivedfrom": null,
"infoschema": "v2.0.0",
"articbedversion": "v3.0",
"collections": [
"WHOLE-GENOME",
"QUICK-LAB",
"ARTIC",
"WASTE-WATER"
]
"WHOLE-GENOME",
"WASTE-WATER",
"ARTIC"
],
"links": {
"protocals": [],
"validation": [],
"homepage": [],
"vendors": [],
"misc": []
},
"description": "Schemes generated for the SARs-CoV-2 Outbreak",
"derivedfrom": null,
"contactinfo": null
}
Loading

0 comments on commit bc97b2f

Please sign in to comment.