Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Jump to bottom

Staging #30

Merged
merged 5 commits into from
May 14, 2024
Merged

Staging #30

Show file tree
Hide file tree
Changes from all commits
Commits
Show all changes
5 commits
Select commit Hold shift + click to select a range
b3a9b1a
Updated Schema for primerschemes/who-tb-amr-panel/1000/v2.0.0
ChrisgKent May 14, 2024
07b0186
Removed amb base from SARS-CoV-2_84_RIGHT_2
ChrisgKent May 14, 2024
c125ff4
Enforced use of V3 bedfiles, Info Scheme V2, and having newline at en…
ChrisgKent May 14, 2024
98a1868
Regenrated json
ChrisgKent May 14, 2024
856335f
Merge branch 'main' into staging
ChrisgKent May 14, 2024
File filter

Filter by extension

Filter by extension
Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
1,413 changes: 706 additions & 707 deletions index.json
View file
Open in desktop

Large diffs are not rendered by default.

24 changes: 17 additions & 7 deletions primerschemes/artic-measles/400/v1.0.0/README.md
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -1,5 +1,7 @@
# artic-measles 400bp v1.0.0

[primalscheme labs](https://labs.primalscheme.com/detail/artic-measles/400/v1.0.0)

## Description

A pan Measles morbillivirus scheme. All full length genomes have been downloaded and phylogenicly downsampled to 0.95 RTL.
Expand All @@ -15,8 +17,8 @@ A pan Measles morbillivirus scheme. All full length genomes have been downloaded
"ampliconsize": 400,
"schemeversion": "v1.0.0",
"schemename": "artic-measles",
"primer_bed_md5": "b8b903356d4c6bd4dc03af04f3a18222",
"reference_fasta_md5": "2c3dd74742a333dffb50bcfbd158bfbd",
"primer_bed_md5": "b75c16322b1e1c5e606917b5653c01f1",
"reference_fasta_md5": "64a52bcc7c18986db1c11813db518390",
"status": "tested",
"citations": [],
"authors": [
Expand All @@ -29,16 +31,24 @@ A pan Measles morbillivirus scheme. All full length genomes have been downloaded
],
"license": "CC BY-SA 4.0",
"primerclass": "primerschemes",
"infoschema": "v1.3.0",
"infoschema": "v2.0.0",
"articbedversion": "v3.0",
"description": "A pan Measles morbillivirus scheme. All full length genomes have been downloaded and phylogenicly downsampled to 0.95 RTL.",
"derivedfrom": null,
"collections": [
"WASTE-WATER",
"QUICK-LAB",
"WHOLE-GENOME",
"WASTE-WATER",
"ARTIC"
]
],
"links": {
"protocals": [],
"validation": [],
"homepage": [],
"vendors": [],
"misc": []
},
"description": "A pan Measles morbillivirus scheme. All full length genomes have been downloaded and phylogenicly downsampled to 0.95 RTL.",
"derivedfrom": null,
"contactinfo": null
}
```

Expand Down
22 changes: 15 additions & 7 deletions primerschemes/artic-measles/400/v1.0.0/info.json
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -2,8 +2,8 @@
"ampliconsize": 400,
"schemeversion": "v1.0.0",
"schemename": "artic-measles",
"primer_bed_md5": "b8b903356d4c6bd4dc03af04f3a18222",
"reference_fasta_md5": "2c3dd74742a333dffb50bcfbd158bfbd",
"primer_bed_md5": "b75c16322b1e1c5e606917b5653c01f1",
"reference_fasta_md5": "64a52bcc7c18986db1c11813db518390",
"status": "tested",
"citations": [],
"authors": [
Expand All @@ -16,14 +16,22 @@
],
"license": "CC BY-SA 4.0",
"primerclass": "primerschemes",
"infoschema": "v1.3.0",
"infoschema": "v2.0.0",
"articbedversion": "v3.0",
"description": "A pan Measles morbillivirus scheme. All full length genomes have been downloaded and phylogenicly downsampled to 0.95 RTL.",
"derivedfrom": null,
"collections": [
"WASTE-WATER",
"QUICK-LAB",
"WHOLE-GENOME",
"WASTE-WATER",
"ARTIC"
]
],
"links": {
"protocals": [],
"validation": [],
"homepage": [],
"vendors": [],
"misc": []
},
"description": "A pan Measles morbillivirus scheme. All full length genomes have been downloaded and phylogenicly downsampled to 0.95 RTL.",
"derivedfrom": null,
"contactinfo": null
}
2 changes: 1 addition & 1 deletion primerschemes/artic-measles/400/v1.0.0/primer.bed
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -372,4 +372,4 @@ NC_001498.1 15858 15888 177e6ebb_46_RIGHT_3 1 - CAAAGCTGGGAATAGAAACTTCGTATTTTC
NC_001498.1 15858 15887 177e6ebb_46_RIGHT_4 1 - CAAAGCTGGGAATAGAACTTCGTATTTTC
NC_001498.1 15858 15887 177e6ebb_46_RIGHT_5 1 - CAAGCTGGGAATAGAAACTTCGTATTTTC
NC_001498.1 15858 15889 177e6ebb_46_RIGHT_6 1 - GACAAACTGGGAATAGAAACTTCGTATTTTC
NC_001498.1 15858 15889 177e6ebb_46_RIGHT_7 1 - GACAAAGTGGGAATAGAAACTTCGTATTTTC
NC_001498.1 15858 15889 177e6ebb_46_RIGHT_7 1 - GACAAAGTGGGAATAGAAACTTCGTATTTTC
2 changes: 1 addition & 1 deletion primerschemes/artic-measles/400/v1.0.0/reference.fasta
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -263,4 +263,4 @@ ATCTCAAGTCCGGTTATCTAGTACTAGACTTACACCAGAATATCTTCGTTAAGAATCTAT
CCAAGTCAGAGAAACAGATTATTATGACGGGGGGTTTAAAACGTGAGTGGGTTTTTAAGG
TAACAGTCAAGGAGACCAAAGAATGGTACAAGTTAGTCGGATACAGCGCTCTGATTAAGG
ATTAATTGGTTGAACTCCGGAACCCTAATCCTGCCCTAGGTAGTTAGGCATTATTTGCAA
TATATTAAAGAAAACTTTGAAAATACGAAGTTTCTATTCCCAGCTTTGTCTGGT
TATATTAAAGAAAACTTTGAAAATACGAAGTTTCTATTCCCAGCTTTGTCTGGT
28 changes: 19 additions & 9 deletions primerschemes/artic-pan-ebola/1000/v1.0.0/README.md
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -1,5 +1,7 @@
# artic-pan-ebola 1000bp v1.0.0

[primalscheme labs](https://labs.primalscheme.com/detail/artic-pan-ebola/1000/v1.0.0)

## Overviews

![NC_006432.1.png](work/NC_006432.1.png)
Expand All @@ -11,8 +13,8 @@
"ampliconsize": 1000,
"schemeversion": "v1.0.0",
"schemename": "artic-pan-ebola",
"primer_bed_md5": "c58ec3b4d07d24499106fed6501016a9",
"reference_fasta_md5": "083c89a1798778fbe94a643d83a6fbb1",
"primer_bed_md5": "6b9554c28693b521cfbe2246091c61af",
"reference_fasta_md5": "c5432a6813f9a2604ea5e5e2bb94508e",
"status": "draft",
"citations": [],
"authors": [
Expand All @@ -25,16 +27,24 @@
],
"license": "CC BY-SA 4.0",
"primerclass": "primerschemes",
"infoschema": "v1.3.0",
"infoschema": "v2.0.0",
"articbedversion": "v3.0",
"description": null,
"derivedfrom": null,
"collections": [
"CLINAL-ISOLATES",
"WHOLE-GENOME",
"QUICK-LAB",
"ARTIC"
]
"WHOLE-GENOME",
"ARTIC",
"CLINAL-ISOLATES"
],
"links": {
"protocals": [],
"validation": [],
"homepage": [],
"vendors": [],
"misc": []
},
"description": null,
"derivedfrom": null,
"contactinfo": null
}
```

Expand Down
26 changes: 17 additions & 9 deletions primerschemes/artic-pan-ebola/1000/v1.0.0/info.json
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -2,8 +2,8 @@
"ampliconsize": 1000,
"schemeversion": "v1.0.0",
"schemename": "artic-pan-ebola",
"primer_bed_md5": "c58ec3b4d07d24499106fed6501016a9",
"reference_fasta_md5": "083c89a1798778fbe94a643d83a6fbb1",
"primer_bed_md5": "6b9554c28693b521cfbe2246091c61af",
"reference_fasta_md5": "c5432a6813f9a2604ea5e5e2bb94508e",
"status": "draft",
"citations": [],
"authors": [
Expand All @@ -16,14 +16,22 @@
],
"license": "CC BY-SA 4.0",
"primerclass": "primerschemes",
"infoschema": "v1.3.0",
"infoschema": "v2.0.0",
"articbedversion": "v3.0",
"description": null,
"derivedfrom": null,
"collections": [
"CLINAL-ISOLATES",
"WHOLE-GENOME",
"QUICK-LAB",
"ARTIC"
]
"WHOLE-GENOME",
"ARTIC",
"CLINAL-ISOLATES"
],
"links": {
"protocals": [],
"validation": [],
"homepage": [],
"vendors": [],
"misc": []
},
"description": null,
"derivedfrom": null,
"contactinfo": null
}
2 changes: 1 addition & 1 deletion primerschemes/artic-pan-ebola/1000/v1.0.0/primer.bed
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -127,4 +127,4 @@ NC_006432.1 17045 17078 81307655_18_LEFT_1 1 + GCCTTACTATTGATCCAGAAATACCAAGTTAAA
NC_006432.1 17045 17078 81307655_18_LEFT_2 1 + GCCTTACTATTGATTCAGAAATACCAAGTTAAG
NC_006432.1 18096 18122 81307655_18_RIGHT_0 1 - CCCTGTCAGCCTTTCAATAAGCTTAA
NC_006432.1 18096 18122 81307655_18_RIGHT_1 1 - CCCTGTCAGCCTTTCGATAAGCTTAA
NC_006432.1 18096 18120 81307655_18_RIGHT_2 1 - TGGTGAGCCGGTCCATAAGTTTTA
NC_006432.1 18096 18120 81307655_18_RIGHT_2 1 - TGGTGAGCCGGTCCATAAGTTTTA
2 changes: 1 addition & 1 deletion primerschemes/artic-pan-ebola/1000/v1.0.0/reference.fasta
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -313,4 +313,4 @@ TATACAGCCAAAATATTTCATAGGGCCGATGGGAATAACATAAGAGGAACATGATCAATG
AACCCTTTATTCCAACTAGGCAGTTGATTGATAATCTACAAATTCCATAAGATGTTCTTA
CGATATTCTTTTGTTTTTAATCTCAATGTCAATGATTTAATAAGTAATAATAAAAAAATC
ACATTAAAGATGCAGGAAGATCTTGACCTCGCCAGGAAAATTAAGCGCACACAAATAAAT
TAAAAAATCTGTATTTTCTCTTTTTTGTGTGTCCA
TAAAAAATCTGTATTTTCTCTTTTTTGTGTGTCCA
30 changes: 20 additions & 10 deletions primerschemes/artic-sars-cov-2/400/v1.0.0/README.md
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -1,5 +1,7 @@
# artic-sars-cov-2 400bp v1.0.0

[primalscheme labs](https://labs.primalscheme.com/detail/artic-sars-cov-2/400/v1.0.0)

## Description

Schemes generated for the SARs-CoV-2 Outbreak
Expand All @@ -13,8 +15,8 @@ Schemes generated for the SARs-CoV-2 Outbreak
"ampliconsize": 400,
"schemeversion": "v1.0.0",
"schemename": "artic-sars-cov-2",
"primer_bed_md5": "578f9cb933e01de0f3e9921cec14e5dc",
"reference_fasta_md5": "92ed86bf00cf94f9daef6acc81a8e48e",
"primer_bed_md5": "c79fcfba30e22def02857c8455576a82",
"reference_fasta_md5": "7f8995394dfc7d5ffeb9fe8322ade58c",
"status": "deprecated",
"citations": [
"https://doi.org/10.1038/nprot.2017.066"
Expand All @@ -29,16 +31,24 @@ Schemes generated for the SARs-CoV-2 Outbreak
],
"license": "CC-BY-4.0",
"primerclass": "primerschemes",
"infoschema": "v1.3.0",
"articbedversion": "v2.0",
"description": "Schemes generated for the SARs-CoV-2 Outbreak",
"derivedfrom": null,
"infoschema": "v2.0.0",
"articbedversion": "v3.0",
"collections": [
"WHOLE-GENOME",
"QUICK-LAB",
"ARTIC",
"WASTE-WATER"
]
"WHOLE-GENOME",
"WASTE-WATER",
"ARTIC"
],
"links": {
"protocals": [],
"validation": [],
"homepage": [],
"vendors": [],
"misc": []
},
"description": "Schemes generated for the SARs-CoV-2 Outbreak",
"derivedfrom": null,
"contactinfo": null
}
```

28 changes: 18 additions & 10 deletions primerschemes/artic-sars-cov-2/400/v1.0.0/info.json
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -2,8 +2,8 @@
"ampliconsize": 400,
"schemeversion": "v1.0.0",
"schemename": "artic-sars-cov-2",
"primer_bed_md5": "578f9cb933e01de0f3e9921cec14e5dc",
"reference_fasta_md5": "92ed86bf00cf94f9daef6acc81a8e48e",
"primer_bed_md5": "c79fcfba30e22def02857c8455576a82",
"reference_fasta_md5": "7f8995394dfc7d5ffeb9fe8322ade58c",
"status": "deprecated",
"citations": [
"https://doi.org/10.1038/nprot.2017.066"
Expand All @@ -18,14 +18,22 @@
],
"license": "CC-BY-4.0",
"primerclass": "primerschemes",
"infoschema": "v1.3.0",
"articbedversion": "v2.0",
"description": "Schemes generated for the SARs-CoV-2 Outbreak",
"derivedfrom": null,
"infoschema": "v2.0.0",
"articbedversion": "v3.0",
"collections": [
"WHOLE-GENOME",
"QUICK-LAB",
"ARTIC",
"WASTE-WATER"
]
"WHOLE-GENOME",
"WASTE-WATER",
"ARTIC"
],
"links": {
"protocals": [],
"validation": [],
"homepage": [],
"vendors": [],
"misc": []
},
"description": "Schemes generated for the SARs-CoV-2 Outbreak",
"derivedfrom": null,
"contactinfo": null
}
Loading
Loading