Updates

2017-07-19

1. Bug fixed: unusual bugs when calculating mismatch thermodynamics.

2017-07-12

1. Enhancement: the function of combined databases is back. It is common to check primers against "genome + rna" at the same time to evaluate primers for gene expression. In theory, there is no limit on the databases for combination, if you have any ideas about database combination, please let me know.

2017-07-06

1. Enhancement: more clear messages for tasks.

2017-07-04

1. Bug fixed: web page crashed when no amplicons found.
2. New feature: allowed mismatch at the 3' end, but exclude the first base at the 3' end. This feature will make MFEprimer more sensitively and accurately, the price is slow.
3. Security: limit the product max size <= 50,000 bp.

2017-07-03

1. Bug fixed: degenerate primers can't recognize correctly.
2. Enhancement: allow single primer sequence for quality check.
3. Enhancement: show the dangerous amplicons count. [amplicons highlighted in red are the ones which have thermodynamics features close to the target amplicon and could be probably amplified in the PCR.]
4. Bug fixed: can't recognize lowercase primer sequences.

2017-07-02

1. Bug fixed: database count bug fixed

2017-06-29

1. Enhancement: in addition to fasta format, input primers now supports sequence-only format. MFEprimer will add an unique primer name like "p1, p2, etc." to name each primer sequences.

Input format 1: fasta format. The main purpose of this format is to help users to name each primers. 
The characters after ">" is the name of this fasta record.

>Seq1
CTACAACCCCACCACGTACC
>Seq2
CGTTACACACTTTGCGGCAA


Input format 2: sequence-only format

CTACAACCCCACCACGTACC
CGTTACACACTTTGCGGCAA

Hybrid formats are also worked now.

>Seq1
CTACAACCCCACCACGTACC
>Seq2
CGTTACACACTTTGCGGCAA
CTTAAATAGGGACCTGTATGAATGGCTC
CCGAAATTTTTAATGCAGGTTTGGTAGT

2017-06-28

1. Enhancement: truncate the amplication name when it's too long to show on a page

2017-06-22

1. Bug fixed: the completed task should not be editable.
2. Enhancement: give detailed error information for user input.

2017-06-21

1. Enhancement: add download link to let users download the complete MFEprimer result in text format (compressed with gzip) which can be opened with "nodepad++" in Windows and Sublimetext in Mac or Linux.
2. Bug fixed: Now, the web page will only show the first 100 predict amplicons (if > 100) to avoid server crashed. In some cases, especially when evaluate primers against 16S DNA sequences, probably there will be > 1000 amplicons. For the whole result, please download the text format.
3. Enhancement: updated the doc pages.

2017-06-07

1. Enhancement: database list view with bootstrap panel.
2. Enhancement: amplicons highlighted in red are the ones which have thermodynamics features close to the target amplicon and could be probably amplified in the PCR.

2017-06-01

1. Enhancement: task view and pagination.

2017-05-31

1. Bug fixed: multiple output primer align diagram.
2. Enhancement: Output primer Tm and Dg value, assuming they binging their complement sequence.