Isolate RNA conversion problem \

when nuc_ variable is assigned \ Cannot determine where the RNA mapping occurs though
reedacartwright · Dec 15, 2017 · f45912e · f45912e
1 parent 73e27a2
commit f45912e
Show file tree

Hide file tree

Showing 3 changed files with 7 additions and 4 deletions.
diff --git a/examples/error.dawg b/examples/error.dawg
@@ -5,7 +5,7 @@ Tree.Tree = "(A:0.3, B:0.2)C;"
 Tree.Scale = 0.99999
 Root.Length = 100
 Root.Code = TCAAAAGGGGTTTTCCCCAAATTAAGGCCCC
-Root.Seq = "lawl"
+Root.Seq = "bad root sequence"
 Sim.Reps = 10
 Sim.Seed = 42
 Root.Seg = 0

diff --git a/examples/rna.dawg b/examples/rna.dawg
@@ -4,7 +4,7 @@ Output.Rna = 1
 Tree.Tree = "(A:0.3, B:0.2)C;"
 Tree.Scale = 0.99999
 Root.Length = 100
-Root.Code = TCAAAAGGGGTTTTCCCCAAATTAAGGCCCC
+Root.Code = 2
 Root.Seq = "AATGCTTTTTTTTTTGGCCAA"
 Sim.Reps = 4
 Sim.Seed = 42

diff --git a/src/include/dawg/residue.h b/src/include/dawg/residue.h
@@ -104,6 +104,7 @@ class residue_exchange {
 		static constexpr char sIns[] = "-+";
 		// table for going from base->char
 		// TODO: Allow codons to be translated into aa
+		// table is 63 wide and 30 down
 		static constexpr char mods[] =
 			"ACGT!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!-" // DNA
 			"acgt!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!-" // dna
@@ -159,7 +160,7 @@ class residue_exchange {
 		rna_ = rna;
 
 		type_ = type; // set sequence type NA, AA, or CODON
-		nuc_ = ((rna) ? MODRNA : MODDNA) | ((lowercase) ? 1 : 0);
+		nuc_ = ((rna) ? MODRNA : MODDNA) | static_cast<unsigned int>((lowercase) ? 1 : 0);
 		code_ = code;
 		if(MODCOD+code_ >= MODEND || mods[(MODCOD+code_)*64] == '!')
 			return DAWG_ERROR("invalid genetic code.");
@@ -169,7 +170,9 @@ class residue_exchange {
 				cs_decode_ = &mods[nuc_*64];
 				break;
 			case AA:
-				cs_decode_ = &mods[(MODAA + (lowercase ? 1 : 0))*64];
+				// if (rna_) cs_decode_ = &mods[nuc_*64];
+				// else
+					cs_decode_ = &mods[(MODAA + (lowercase ? 1 : 0))*64];
 				break;
 			case CODON:
 				cs_decode_ = &mods[(MODCOD+code_)*64];