ViennaRNA Package 2.0.7

The Vienna RNA Package consists of a C code library and several
stand-alone programs for the prediction and comparison of RNA secondary
structures.

Closes #16.

Signed-off-by: Max Howell <mxcl@me.com>

viennarna.rb

@@ -0,0 +1,47 @@
+require 'formula'
+
+class Viennarna < Formula
+  homepage 'http://www.tbi.univie.ac.at/~ivo/RNA/'
+  url 'http://www.tbi.univie.ac.at/~ronny/RNA/ViennaRNA-2.0.7.tar.gz'
+  sha1 'eced95b1cb5d09acb4dbd372a2b11ac48e19344b'
+
+  def install
+    ENV['ARCHFLAGS'] = "-arch x86_64"
+    config_command = ["./configure", "--disable-debug", "--disable-dependency-tracking",
+                      "--prefix=#{prefix}", "--disable-openmp"]
+    config_command.push('--without-perl') unless ARGV.include? '--with-perl'
+    system *config_command
+    system "make install"
+  end
+
+  def options
+    [
+      ['--with-perl', 'Build and Install Perl Interfaces.']
+    ]
+  end
+
+  def patches
+    DATA
+  end
+
+  def test
+    # This test will fail and we won't accept that! It's enough to just replace
+    # "false" with the main program this formula installs, but it'd be nice if you
+    # were more thorough. Run the test with `brew test ViennaRNA`.
+    system "echo 'GGGGCUAUAGCUCAGCUGGGAGAGCGCUUGCAUGGCAUGCAAGAGGUCAGCGGUUCGAUCCCGCUUAGCUCCACCA' | RNAFold"
+  end
+end
+
+__END__
+--- ViennaRNA-2.0.7/Makefile.in	2012-06-15 10:39:46.000000000 +0900
++++ ViennaRNA-2.0.7/Makefile.in.new	2012-06-15 10:26:15.000000000 +0900
+@@ -830,8 +830,7 @@
+
+ info-am:
+
+-install-data-am: install-dist_docDATA install-dist_docdir_htmlDATA \
+-	install-docDATA install-docdir_htmlDATA install-pkgconfigDATA \
++install-data-am: 	install-docDATA install-docdir_htmlDATA install-pkgconfigDATA \
+	install-pkgdataDATA
+
+ install-dvi: install-dvi-recursive