[MISC] Do not throw in destructor

seqan · Dec 6, 2019 · a1335e7 · a1335e7
1 parent 1d0c24b
commit a1335e7
Show file tree

Hide file tree

Showing 9 changed files with 115 additions and 23 deletions.
diff --git a/doc/tutorial/alignment_file/alignment_file_snippets.cpp b/doc/tutorial/alignment_file/alignment_file_snippets.cpp
@@ -1,4 +1,6 @@
 #include <fstream>
+
+#include <seqan3/core/debug_stream.hpp>
 #include <seqan3/std/filesystem>
 
 //![include_aligned_sequence]
@@ -7,6 +9,8 @@
 
 struct write_file_dummy_struct
 {
+    std::filesystem::path const file_path = std::filesystem::temp_directory_path()/"example.sam";
+
     write_file_dummy_struct()
     {
 
@@ -20,14 +24,18 @@ r003	2064	ref	29	17	5M	*	0	0	TAGGC	*
 r001	147	ref	37	30	9M	=	7	-39	CAGCGGCAT	*	NM:i:1
 )//![sam_file]";
 
-        std::ofstream file{std::filesystem::temp_directory_path()/"example.sam"};
+        std::ofstream file{file_path};
         std::string str{file_raw};
         file << str.substr(1); // skip first newline
     }
 
     ~write_file_dummy_struct()
     {
-        std::filesystem::remove(std::filesystem::temp_directory_path()/"example.sam");
+        std::error_code ec{};
+        std::filesystem::remove(file_path, ec);
+
+        if (ec)
+            seqan3::debug_stream << "[WARNING] Could not delete " << file_path << ". " << ec.message() << '\n';
     }
 };
 

diff --git a/doc/tutorial/alignment_file/alignment_file_solution2.cpp b/doc/tutorial/alignment_file/alignment_file_solution2.cpp
@@ -1,11 +1,15 @@
 #include <fstream>
 
+#include <seqan3/core/debug_stream.hpp>
 #include <seqan3/std/filesystem>
 
 struct write_file_dummy_struct
 {
+    std::filesystem::path const tmp_path = std::filesystem::temp_directory_path();
+
     write_file_dummy_struct()
     {
+
 auto fasta_file_raw = R"//![ref_file](
 >chr1
 ACAGCAGGCATCTATCGGCGGATCGATCAGGCAGGCAGCTACTGG
@@ -23,19 +27,30 @@ r004	0	chr2	16	60	6M14N5M	*	0	0	ATAGCTTCAGC	*
 r003	2064	chr2	18	10	5M	*	0	0	TAGGC	*
 )//![sam_file]";
 
-        std::ofstream file{std::filesystem::temp_directory_path()/"mapping.sam"};
+        std::ofstream file{tmp_path/"mapping.sam"};
         std::string str{file_raw};
         file << str.substr(1); // skip first newline
 
-        std::ofstream reffile{std::filesystem::temp_directory_path()/"reference.fasta"};
+        std::ofstream reffile{tmp_path/"reference.fasta"};
         std::string fasta_file_rawstr{fasta_file_raw};
         reffile << fasta_file_rawstr.substr(1); // skip first newline
     }
 
     ~write_file_dummy_struct()
     {
-        std::filesystem::remove(std::filesystem::temp_directory_path()/"mapping.sam");
-        std::filesystem::remove(std::filesystem::temp_directory_path()/"reference.fasta");
+        std::error_code ec{};
+        std::filesystem::path file_path{};
+
+        file_path = tmp_path/"mapping.sam";
+        std::filesystem::remove(file_path, ec);
+        if (ec)
+            seqan3::debug_stream << "[WARNING] Could not delete " << file_path << ". " << ec.message() << '\n';
+
+        file_path = tmp_path/"reference.fasta";
+        std::filesystem::remove(file_path, ec);
+        if (ec)
+            seqan3::debug_stream << "[WARNING] Could not delete " << file_path << ". " << ec.message() << '\n';
+
     }
 };
 

diff --git a/doc/tutorial/sequence_file/sequence_file_snippets.cpp b/doc/tutorial/sequence_file/sequence_file_snippets.cpp
@@ -20,6 +20,8 @@
 
 struct write_file_dummy_struct
 {
+    std::filesystem::path const tmp_path = std::filesystem::temp_directory_path();
+
     write_file_dummy_struct()
     {
 
@@ -38,22 +40,36 @@ AGCGATCGAGGAATATAT
 IIIIHHGIIIIHHGIIIH
 )//![fastq_file]";
 
-        std::ofstream file{std::filesystem::temp_directory_path()/"my.fastq"};
+        std::ofstream file{tmp_path/"my.fastq"};
         std::string str{file_raw};
         file << str.substr(1); // skip first newline
 
-        std::ofstream file2{std::filesystem::temp_directory_path()/"my.qq"};
+        std::ofstream file2{tmp_path/"my.qq"};
         file2 << str.substr(1); // skip first newline
 
-        std::ofstream file3{std::filesystem::temp_directory_path()/"my.fasta"};
+        std::ofstream file3{tmp_path/"my.fasta"};
         file3 << ">seq1\nAVAV\n>seq2\nAVAVA\n";
     }
 
     ~write_file_dummy_struct()
     {
-        std::filesystem::remove(std::filesystem::temp_directory_path()/"my.fastq");
-        std::filesystem::remove(std::filesystem::temp_directory_path()/"my.qq");
-        std::filesystem::remove(std::filesystem::temp_directory_path()/"my.fasta");
+        std::error_code ec{};
+        std::filesystem::path file_path{};
+
+        file_path = tmp_path/"my.fastq";
+        std::filesystem::remove(file_path, ec);
+        if (ec)
+            seqan3::debug_stream << "[WARNING] Could not delete " << file_path << ". " << ec.message() << '\n';
+
+        file_path = tmp_path/"my.qq";
+        std::filesystem::remove(file_path, ec);
+        if (ec)
+            seqan3::debug_stream << "[WARNING] Could not delete " << file_path << ". " << ec.message() << '\n';
+
+        file_path = tmp_path/"my.fasta";
+        std::filesystem::remove(file_path, ec);
+        if (ec)
+            seqan3::debug_stream << "[WARNING] Could not delete " << file_path << ". " << ec.message() << '\n';
     }
 };
 
@@ -178,5 +194,4 @@ sequence_file_output{tmp_dir/"output.fasta"} = sequence_file_input{tmp_dir/"my.f
 
 std::filesystem::remove(std::filesystem::temp_directory_path()/"output.fasta");
 std::filesystem::remove(std::filesystem::temp_directory_path()/"output.fastq");
-
 }
diff --git a/doc/tutorial/sequence_file/sequence_file_solution1.cpp b/doc/tutorial/sequence_file/sequence_file_solution1.cpp
@@ -1,9 +1,12 @@
 #include <fstream>
 
+#include <seqan3/core/debug_stream.hpp>
 #include <seqan3/std/filesystem>
 
 struct write_file_dummy_struct
 {
+    std::filesystem::path const file_path = std::filesystem::temp_directory_path()/"my.fastq";
+
     write_file_dummy_struct()
     {
 
@@ -22,14 +25,18 @@ AGCGATCGAGGAATATAT
 IIIIHHGIIIIHHGIIIH
 )//![fastq_file]";
 
-        std::ofstream file{std::filesystem::temp_directory_path()/"my.fastq"};
+        std::ofstream file{file_path};
         std::string str{file_raw};
         file << str.substr(1); // skip first newline
     }
 
     ~write_file_dummy_struct()
     {
-        std::filesystem::remove(std::filesystem::temp_directory_path()/"my.fastq");
+        std::error_code ec{};
+        std::filesystem::remove(file_path, ec);
+
+        if (ec)
+            seqan3::debug_stream << "[WARNING] Could not delete " << file_path << ". " << ec.message() << '\n';
     }
 };
 

diff --git a/doc/tutorial/sequence_file/sequence_file_solution2.cpp b/doc/tutorial/sequence_file/sequence_file_solution2.cpp
@@ -1,9 +1,12 @@
 #include <fstream>
 
+#include <seqan3/core/debug_stream.hpp>
 #include <seqan3/std/filesystem>
 
 struct write_file_dummy_struct
 {
+    std::filesystem::path const file_path = std::filesystem::temp_directory_path()/"my.fasta";
+
     write_file_dummy_struct()
     {
 
@@ -14,14 +17,18 @@ AGCT
 CGATCGA
 )//![fasta_file]";
 
-        std::ofstream file{std::filesystem::temp_directory_path()/"my.fasta"};
+        std::ofstream file{file_path};
         std::string str{file_raw};
         file << str.substr(1); // skip first newline
     }
 
     ~write_file_dummy_struct()
     {
-        std::filesystem::remove(std::filesystem::temp_directory_path()/"my.fastq");
+        std::error_code ec{};
+        std::filesystem::remove(file_path, ec);
+
+        if (ec)
+            seqan3::debug_stream << "[WARNING] Could not delete " << file_path << ". " << ec.message() << '\n';
     }
 };
 

diff --git a/doc/tutorial/sequence_file/sequence_file_solution3.cpp b/doc/tutorial/sequence_file/sequence_file_solution3.cpp
@@ -1,9 +1,12 @@
 #include <fstream>
 
+#include <seqan3/core/debug_stream.hpp>
 #include <seqan3/std/filesystem>
 
 struct write_file_dummy_struct
 {
+    std::filesystem::path const file_path = std::filesystem::temp_directory_path()/"my.fastq";
+
     write_file_dummy_struct()
     {
 
@@ -30,14 +33,18 @@ AGCTAGCAGCGATCG
 IIIIIHIIJJIIIII
 )//![fastq_file]";
 
-        std::ofstream file{std::filesystem::temp_directory_path()/"my.fastq"};
+        std::ofstream file{file_path};
         std::string str{file_raw};
         file << str.substr(1); // skip first newline
     }
 
     ~write_file_dummy_struct()
     {
-        std::filesystem::remove(std::filesystem::temp_directory_path()/"my.fastq");
+        std::error_code ec{};
+        std::filesystem::remove(file_path, ec);
+
+        if (ec)
+            seqan3::debug_stream << "[WARNING] Could not delete " << file_path << ". " << ec.message() << '\n';
     }
 };
 

diff --git a/doc/tutorial/sequence_file/sequence_file_solution4.cpp b/doc/tutorial/sequence_file/sequence_file_solution4.cpp
@@ -1,9 +1,12 @@
 #include <fstream>
 
+#include <seqan3/core/debug_stream.hpp>
 #include <seqan3/std/filesystem>
 
 struct write_file_dummy_struct
 {
+    std::filesystem::path const tmp_path = std::filesystem::temp_directory_path();
+
     write_file_dummy_struct()
     {
 
@@ -30,14 +33,26 @@ AGCTAGCAGCGATCG
 IIIIIHIIJJIIIII
 )//![fastq_file]";
 
-        std::ofstream file{std::filesystem::temp_directory_path()/"my.fastq"};
+        std::ofstream file{tmp_path/"my.fastq"};
         std::string str{file_raw};
         file << str.substr(1); // skip first newline
     }
 
     ~write_file_dummy_struct()
     {
-        std::filesystem::remove(std::filesystem::temp_directory_path()/"my.fastq");
+        std::error_code ec{};
+        std::filesystem::path file_path{};
+
+        file_path = tmp_path/"my.fastq";
+        std::filesystem::remove(file_path, ec);
+        if (ec)
+            seqan3::debug_stream << "[WARNING] Could not delete " << file_path << ". " << ec.message() << '\n';
+
+        file_path = tmp_path/"output.fastq";
+        std::filesystem::remove(file_path, ec);
+        if (ec)
+            seqan3::debug_stream << "[WARNING] Could not delete " << file_path << ". " << ec.message() << '\n';
+
     }
 };
 

diff --git a/doc/tutorial/sequence_file/sequence_file_solution5.cpp b/doc/tutorial/sequence_file/sequence_file_solution5.cpp
@@ -1,9 +1,12 @@
 #include <fstream>
 
+#include <seqan3/core/debug_stream.hpp>
 #include <seqan3/std/filesystem>
 
 struct write_file_dummy_struct
 {
+    std::filesystem::path const tmp_path = std::filesystem::temp_directory_path();
+
     write_file_dummy_struct()
     {
 
@@ -30,14 +33,26 @@ AGCTAGCAGCGATCG
 IIIIIHIIJJIIIII
 )//![fastq_file]";
 
-        std::ofstream file{std::filesystem::temp_directory_path()/"my.fastq"};
+        std::ofstream file{tmp_path/"my.fastq"};
         std::string str{file_raw};
         file << str.substr(1); // skip first newline
     }
 
     ~write_file_dummy_struct()
     {
-        std::filesystem::remove(std::filesystem::temp_directory_path()/"my.fastq");
+        std::error_code ec{};
+        std::filesystem::path file_path{};
+
+        file_path = tmp_path/"my.fastq";
+        std::filesystem::remove(file_path, ec);
+        if (ec)
+            seqan3::debug_stream << "[WARNING] Could not delete " << file_path << ". " << ec.message() << '\n';
+
+        file_path = tmp_path/"output.fastq";
+        std::filesystem::remove(file_path, ec);
+        if (ec)
+            seqan3::debug_stream << "[WARNING] Could not delete " << file_path << ". " << ec.message() << '\n';
+
     }
 };
 

diff --git a/test/include/seqan3/test/tmp_filename.hpp b/test/include/seqan3/test/tmp_filename.hpp
@@ -118,6 +118,9 @@ class tmp_filename
     }
 
     /*!\brief Destructs the temporary directory path.
+     *
+     * \details
+     *
      * Removes the temporary directory and all its subdirectories and files contained.
      */
     ~tmp_filename()