Add subseq selected coordinates to FASTA?

[photocyte]

Prerequisites

• make sure you're are using the latest version by seqkit version
• read the usage

Describe your issue

• describe the problem
• provide a reproducible example

Hi there,

It would be useful for subseq to have a flag where it would add the coordinates of the selected region to the FASTA record description.

E.g. if subseq were run with -r 14:14 it would add SEQID:14-14 to the end of the FASTA description. It would ideally work with GTF/GFF & BED defined regions as well, but would need to change from 0-indexing to 1-indexing in the case of BED.

I briefly looked and the analogous command to subseq in seqtk does not have this feature. bedtools getfasta implements this behavior by default.

All the best,
-Tim

[photocyte]

On further testing, seqkit subseq --bed already does this, but in a different format than bedtools. The existing seqkit output looks like the below, where prot1 is the seqid:

>prot1_2661-2685:.

However, the coordinates don't get appended with the -r flag. seqkit subseq -r 2661:2685 gives:

>prot1

[shenwei356]

Added one.

  -R, --region-coord      append coordinates to sequence ID for -r/--region

• seqkit_darwin_arm64.tar.gz
• seqkit_linux_amd64.tar.gz
• seqkit_darwin_amd64.tar.gz

$ seqkit head -n 1 ../tests/hairpin.fa 
>cel-let-7 MI0000001 Caenorhabditis elegans let-7 stem-loop
UACACUGUGGAUCCGGUGAGGUAGUAGGUUGUAUAGUUUGGAAUAUUACCACCGGUGAAC
UAUGCAAUUUUCUACCUUACCGGAGACAGAACUCUUCGA

$ seqkit head -n 1 ../tests/hairpin.fa \
    | ./seqkit subseq -r 1:10 -R
>cel-let-7:1-10 MI0000001 Caenorhabditis elegans let-7 stem-loop
UACACUGUGG