-
Notifications
You must be signed in to change notification settings - Fork 176
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
- Loading branch information
1 parent
48f70c2
commit 2acceca
Showing
9 changed files
with
50 additions
and
0 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,5 @@ | ||
channels: | ||
- bioconda | ||
- r | ||
dependencies: | ||
- pindel ==0.2.5b8 |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,4 @@ | ||
name: pindel | ||
description: Call variants with pindel. | ||
authors: | ||
- Johannes Köster |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,16 @@ | ||
rule pindel: | ||
input: | ||
ref="genome.fasta", | ||
# samples to call | ||
samples=["mapped/a.bam"], | ||
# bam configuration file, see http://gmt.genome.wustl.edu/packages/pindel/quick-start.html | ||
config="pindel_config.txt" | ||
output: | ||
"calls/pindel.vcf" | ||
params: | ||
"" # optional parameters (except -i, -f, -o) | ||
log: | ||
"logs/pindel.log" | ||
threads: 4 | ||
wrapper: | ||
"master/bio/pindel" |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,2 @@ | ||
>Sheila | ||
GCTAGCTCAGAAAAAAAAAA |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1 @@ | ||
Sheila 20 8 20 21 |
Binary file not shown.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1 @@ | ||
mapped/a.bam 300 a |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,8 @@ | ||
import subprocess | ||
import os | ||
|
||
def setup_module(): | ||
os.chdir(os.path.join(os.path.dirname(__file__), "test")) | ||
|
||
def test(): | ||
subprocess.check_call(["snakemake", "calls/pindel.vcf", "--use-conda", "-F"]) |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,13 @@ | ||
__author__ = "Johannes Köster" | ||
__copyright__ = "Copyright 2016, Johannes Köster" | ||
__email__ = "koester@jimmy.harvard.edu" | ||
__license__ = "MIT" | ||
|
||
import os | ||
from snakemake.shell import shell | ||
|
||
|
||
log = snakemake.log_fmt_shell(stdout=True, stderr=True) | ||
prefix = os.path.dirname(snakemake.output[0]) | ||
|
||
shell("pindel {params} -i {snakemake.input.conf} -f {snakemake.input.ref} -o {prefix} {log}") |