Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Jump to bottom

missing handling of small number of input reads #26

Open
mr-eyes opened this issue May 25, 2020 · 7 comments
Open

missing handling of small number of input reads #26

mr-eyes opened this issue May 25, 2020 · 7 comments

Comments

@mr-eyes
Copy link

mr-eyes commented May 25, 2020 •
edited

Expected Behavior

Throw an exception or end the program if the number of reads is small that it will fail to be assembled.

Current Behavior

Entered an infinite loop running on 24 threads (Different from the provided --threads parameter).

Steps to Reproduce (for bugs)

Create fastq files

R1.fastq 
@SRR11015356.20904790
AGGGAACCAACTACAGACTGGGGGGACAACTCAGTGGTTAGGGTCACGTGTTCTTCTTGTGGCGGATGAGGGTTGGGATCCCAGAACCCACATGGGAGTCTCCAACCACCTGTAACTCTAGTTCCAGGCGACCCGATGATGGCCACCTCTG
+
???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????
@SRR11015356.20907155
AGGGAACCAACTACAGACTGGGGGGACAACTCAGTGGTTAGGGTCACGTGTTCTTCTTGTGGCGGATGAGGGTTGGGATCCCAGAACCCACATGGGAGTCTCCAACCACCTGTAACTCTAGTTCCAGGCGACCCGATGATGGCCACCTCTG
+
???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????
R2.fastq 
@SRR11015356.20904790
TTTTGAAGCCACTATATGATCCAGAATGAAACTGTAGGAAACCAAGCTCCAGCCTAAAAAAGCCTCATCAATTTTTTTAAAAGAATTTTGTTTTTAGGTTTATGTTTTTATTTTGTGTGCAAGAGAGTTTTTCCTGCCTGTGTGTATGAGC
+
???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????
@SRR11015356.20907155
TTTTGAAGCCACTATATGATCCAGAATGAAACTGTAGGAAACCAAGCTCCAGCCTAAAAAAGCCTCATCAATTTTTTTAAAAGAATTTTGTTTTTAGGTTTATGTTTTTATTTTGTGTGCAAGAGAGTTTTTCCTGCCTGTGTGTATGAGC
+
???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????

Plass Output (for bugs)

  • cmd: plass nuclassemble R1.fastq R2.fastq assembled.fa tmp --threads 2 -v 3
Plass Output Log 
MMseqs Version:                     	3.764a3
Check for circular sequences        	true
Minimum contig length               	1000
Clustering threshold                	0.97
Number search iterations            	12
Remove temporary files              	false
Delete temporary files incremental  	1
MPI runner                          	
Substitution matrix                 	nucl:nucleotide.out,aa:blosum62.out
Alphabet size                       	5
Seq. id. threshold                  	0.97
K-mers per sequence                 	60
scale k-mers per sequence           	0.1
Adjust k-mer length                 	false
Mask residues                       	0
Mask lower case residues            	0
Coverage mode                       	0
K-mer size                          	22
Coverage threshold                  	0
Max sequence length                 	65535
Shift hash                          	5
Split memory limit                  	0
Include only extendable             	true
Skip repeating k-mers               	true
Threads                             	2
Compressed                          	0
Verbosity                           	3
Rescore mode                        	3
Allow wrapped scoring               	false
Remove hits by seq. id. and coverage	false
E-value threshold                   	1e-05
Add backtrace                       	false
Min. alignment length               	0
Seq. id. mode                       	0
Include identical seq. id.          	false
Sort results                        	0
Preload mode                        	0
Chop Cycle                          	true

Temporary folder tmp does not exist or is not a directory.
Created directory tmp
PAIRED END MODE
mergereads R1.fastq R2.fastq /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/nucl_reads -v 3 

Start merging reads.
Time for merging to nucl_reads: 0h 0m 0s 0ms
Time for merging to nucl_reads_h: 0h 0m 0s 0ms

Done.
Time for processing: 0h 0m 0s 0ms
STEP: 0
kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/nucl_reads /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_0 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 

kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/nucl_reads /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_0 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 

Database size: 4 type: Nucleotide

Estimated memory consumption 0 MB
Generate k-mers list for 1 split
[=================================================================] 100.00% 4 0s 0ms      

Adjusted k-mer length 22
Sort kmer 0h 0m 0s 0ms
Sort by rep. sequence 0h 0m 0s 0ms
Time for fill: 0h 0m 0s 0ms
Time for merging to pref_0: 0h 0m 0s 0ms
Time for processing: 0h 0m 0s 1ms
rescorediagonal /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/nucl_reads /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/nucl_reads /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_0 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_0 --sub-mat nucl:nucleotide.out,aa:blosum62.out --rescore-mode 3 --wrapped-scoring 0 --filter-hits 0 -e 1e-05 -c 0 -a 0 --cov-mode 0 --min-seq-id 0.97 --min-aln-len 0 --seq-id-mode 0 --add-self-matches 0 --sort-results 0 --db-load-mode 0 --threads 2 --compressed 0 -v 3 

[=================================================================] 100.00% 4 0s 0ms      
Time for merging to aln_0: 0h 0m 0s 0ms=====>                     ] 66.67% 3 eta 0s       
Time for processing: 0h 0m 0s 1ms
assembleresults /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/nucl_reads /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_0 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_0 --min-seq-id 0.97 --max-seq-len 65535 --threads 2 -v 3 --rescore-mode 3 

Compute assembly.
[=================================================================] 100.00% 4 0s 0ms      
Time for merging to assembly_0: 0h 0m 0s 0ms

Done.
Time for processing: 0h 0m 0s 3ms
cyclecheck /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_0 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_0_cycle --max-seq-len 65535 --chop-cycle 1 --threads 2 -v 3 

Time for merging to assembly_0_cycle: 0h 0m 0s 0ms
Time for processing: 0h 0m 0s 0ms
STEP: 1
kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_0_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_1 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 

kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_0_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_1 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 

Database size: 4 type: Nucleotide

Estimated memory consumption 0 MB
Generate k-mers list for 1 split
[=================================================================] 100.00% 4 0s 0ms      

Adjusted k-mer length 22
Sort kmer 0h 0m 0s 0ms
Sort by rep. sequence 0h 0m 0s 0ms
Time for fill: 0h 0m 0s 0ms
Time for merging to pref_1: 0h 0m 0s 0ms
Time for processing: 0h 0m 0s 2ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_0 

Time for processing: 0h 0m 0s 0ms
rescorediagonal /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_0_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_0_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_1 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_1 --sub-mat nucl:nucleotide.out,aa:blosum62.out --rescore-mode 3 --wrapped-scoring 0 --filter-hits 0 -e 1e-05 -c 0 -a 0 --cov-mode 0 --min-seq-id 0.97 --min-aln-len 0 --seq-id-mode 0 --add-self-matches 0 --sort-results 0 --db-load-mode 0 --threads 2 --compressed 0 -v 3 

[=================================================================] 100.00% 4 0s 0ms      
Time for merging to aln_1: 0h 0m 0s 0ms
Time for processing: 0h 0m 0s 1ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_0 

Time for processing: 0h 0m 0s 0ms
assembleresults /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_0_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_1 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_1 --min-seq-id 0.97 --max-seq-len 65535 --threads 2 -v 3 --rescore-mode 3 

Compute assembly.
[=================================================================] 100.00% 4 0s 1ms      
Time for merging to assembly_1: 0h 0m 0s 0ms

Done.
Time for processing: 0h 0m 0s 5ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_0_noneCycle 

Time for processing: 0h 0m 0s 0ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_0 

Time for processing: 0h 0m 0s 0ms
cyclecheck /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_1 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_1_cycle --max-seq-len 65535 --chop-cycle 1 --threads 2 -v 3 

Time for merging to assembly_1_cycle: 0h 0m 0s 0ms
Time for processing: 0h 0m 0s 1ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_0_cycle 

Time for processing: 0h 0m 0s 0ms
STEP: 2
kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_1_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_2 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 

kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_1_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_2 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 

Database size: 4 type: Nucleotide

Estimated memory consumption 0 MB
Generate k-mers list for 1 split
[=================================================================] 100.00% 4 0s 0ms      

Adjusted k-mer length 22
Sort kmer 0h 0m 0s 0ms
Sort by rep. sequence 0h 0m 0s 0ms
Time for fill: 0h 0m 0s 0ms
Time for merging to pref_2: 0h 0m 0s 0ms
Time for processing: 0h 0m 0s 1ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_1 

Time for processing: 0h 0m 0s 0ms
rescorediagonal /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_1_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_1_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_2 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_2 --sub-mat nucl:nucleotide.out,aa:blosum62.out --rescore-mode 3 --wrapped-scoring 0 --filter-hits 0 -e 1e-05 -c 0 -a 0 --cov-mode 0 --min-seq-id 0.97 --min-aln-len 0 --seq-id-mode 0 --add-self-matches 0 --sort-results 0 --db-load-mode 0 --threads 2 --compressed 0 -v 3 

[=================================================================] 100.00% 4 0s 0ms      
Time for merging to aln_2: 0h 0m 0s 0ms
Time for processing: 0h 0m 0s 1ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_1 

Time for processing: 0h 0m 0s 0ms
assembleresults /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_1_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_2 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_2 --min-seq-id 0.97 --max-seq-len 65535 --threads 2 -v 3 --rescore-mode 3 

Compute assembly.
[=================================================================] 100.00% 4 0s 0ms      
Time for merging to assembly_2: 0h 0m 0s 0ms

Done.
Time for processing: 0h 0m 0s 1ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_1_noneCycle 

Time for processing: 0h 0m 0s 0ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_1 

Time for processing: 0h 0m 0s 0ms
cyclecheck /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_2 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_2_cycle --max-seq-len 65535 --chop-cycle 1 --threads 2 -v 3 

Time for merging to assembly_2_cycle: 0h 0m 0s 0ms
Time for processing: 0h 0m 0s 0ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_1_cycle 

Time for processing: 0h 0m 0s 0ms
STEP: 3
kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_2_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_3 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 

kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_2_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_3 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 

Database size: 4 type: Nucleotide

Estimated memory consumption 0 MB
Generate k-mers list for 1 split
[=================================================================] 100.00% 4 0s 0ms      

Adjusted k-mer length 22
Sort kmer 0h 0m 0s 0ms
Sort by rep. sequence 0h 0m 0s 0ms
Time for fill: 0h 0m 0s 0ms
Time for merging to pref_3: 0h 0m 0s 0ms
Time for processing: 0h 0m 0s 1ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_2 

Time for processing: 0h 0m 0s 0ms
rescorediagonal /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_2_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_2_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_3 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_3 --sub-mat nucl:nucleotide.out,aa:blosum62.out --rescore-mode 3 --wrapped-scoring 0 --filter-hits 0 -e 1e-05 -c 0 -a 0 --cov-mode 0 --min-seq-id 0.97 --min-aln-len 0 --seq-id-mode 0 --add-self-matches 0 --sort-results 0 --db-load-mode 0 --threads 2 --compressed 0 -v 3 

[=================================================================] 100.00% 4 0s 0ms      
Time for merging to aln_3: 0h 0m 0s 0ms                           ] 33.33% 2 eta 0s       
Time for processing: 0h 0m 0s 1ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_2 

Time for processing: 0h 0m 0s 0ms
assembleresults /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_2_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_3 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_3 --min-seq-id 0.97 --max-seq-len 65535 --threads 2 -v 3 --rescore-mode 3 

Compute assembly.
[=================================================================] 100.00% 4 0s 0ms      
Time for merging to assembly_3: 0h 0m 0s 0ms

Done.
Time for processing: 0h 0m 0s 1ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_2_noneCycle 

Time for processing: 0h 0m 0s 0ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_2 

Time for processing: 0h 0m 0s 0ms
cyclecheck /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_3 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_3_cycle --max-seq-len 65535 --chop-cycle 1 --threads 2 -v 3 

Time for merging to assembly_3_cycle: 0h 0m 0s 0ms
Time for processing: 0h 0m 0s 0ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_2_cycle 

Time for processing: 0h 0m 0s 0ms
STEP: 4
kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_3_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_4 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 

kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_3_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_4 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 

Database size: 4 type: Nucleotide

Estimated memory consumption 0 MB
Generate k-mers list for 1 split
[=================================================================] 100.00% 4 0s 0ms      

Adjusted k-mer length 22
Sort kmer 0h 0m 0s 0ms
Sort by rep. sequence 0h 0m 0s 0ms
Time for fill: 0h 0m 0s 0ms
Time for merging to pref_4: 0h 0m 0s 0ms
Time for processing: 0h 0m 0s 1ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_3 

Time for processing: 0h 0m 0s 0ms
rescorediagonal /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_3_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_3_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_4 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_4 --sub-mat nucl:nucleotide.out,aa:blosum62.out --rescore-mode 3 --wrapped-scoring 0 --filter-hits 0 -e 1e-05 -c 0 -a 0 --cov-mode 0 --min-seq-id 0.97 --min-aln-len 0 --seq-id-mode 0 --add-self-matches 0 --sort-results 0 --db-load-mode 0 --threads 2 --compressed 0 -v 3 

[=================================================================] 100.00% 4 0s 0ms      
Time for merging to aln_4: 0h 0m 0s 0ms
Time for processing: 0h 0m 0s 1ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_3 

Time for processing: 0h 0m 0s 0ms
assembleresults /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_3_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_4 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_4 --min-seq-id 0.97 --max-seq-len 65535 --threads 2 -v 3 --rescore-mode 3 

Compute assembly.
[=================================================================] 100.00% 4 0s 0ms      
Time for merging to assembly_4: 0h 0m 0s 0ms

Done.
Time for processing: 0h 0m 0s 1ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_3_noneCycle 

Time for processing: 0h 0m 0s 0ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_3 

Time for processing: 0h 0m 0s 0ms
cyclecheck /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_4 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_4_cycle --max-seq-len 65535 --chop-cycle 1 --threads 2 -v 3 

Time for merging to assembly_4_cycle: 0h 0m 0s 0ms
Time for processing: 0h 0m 0s 1ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_3_cycle 

Time for processing: 0h 0m 0s 0ms
STEP: 5
kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_4_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_5 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 

kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_4_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_5 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 

Database size: 4 type: Nucleotide

Estimated memory consumption 0 MB
Generate k-mers list for 1 split
[=================================================================] 100.00% 4 0s 0ms      

Adjusted k-mer length 22
Sort kmer 0h 0m 0s 0ms
Sort by rep. sequence 0h 0m 0s 0ms
Time for fill: 0h 0m 0s 0ms
Time for merging to pref_5: 0h 0m 0s 0ms
Time for processing: 0h 0m 0s 1ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_4 

Time for processing: 0h 0m 0s 0ms
rescorediagonal /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_4_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_4_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_5 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_5 --sub-mat nucl:nucleotide.out,aa:blosum62.out --rescore-mode 3 --wrapped-scoring 0 --filter-hits 0 -e 1e-05 -c 0 -a 0 --cov-mode 0 --min-seq-id 0.97 --min-aln-len 0 --seq-id-mode 0 --add-self-matches 0 --sort-results 0 --db-load-mode 0 --threads 2 --compressed 0 -v 3 

[=================================================================] 100.00% 4 0s 0ms      
Time for merging to aln_5: 0h 0m 0s 0ms
Time for processing: 0h 0m 0s 1ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_4 

Time for processing: 0h 0m 0s 0ms
assembleresults /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_4_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_5 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_5 --min-seq-id 0.97 --max-seq-len 65535 --threads 2 -v 3 --rescore-mode 3 

Compute assembly.
[=================================================================] 100.00% 4 0s 0ms      
Time for merging to assembly_5: 0h 0m 0s 0ms

Done.
Time for processing: 0h 0m 0s 1ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_4_noneCycle 

Time for processing: 0h 0m 0s 0ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_4 

Time for processing: 0h 0m 0s 0ms
cyclecheck /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_5 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_5_cycle --max-seq-len 65535 --chop-cycle 1 --threads 2 -v 3 

Time for merging to assembly_5_cycle: 0h 0m 0s 0ms
Time for processing: 0h 0m 0s 0ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_4_cycle 

Time for processing: 0h 0m 0s 0ms
STEP: 6
kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_5_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_6 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 

kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_5_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_6 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 

Database size: 4 type: Nucleotide

Estimated memory consumption 0 MB
Generate k-mers list for 1 split
[=================================================================] 100.00% 4 0s 0ms      

Adjusted k-mer length 22
Sort kmer 0h 0m 0s 0ms
Sort by rep. sequence 0h 0m 0s 0ms
Time for fill: 0h 0m 0s 0ms
Time for merging to pref_6: 0h 0m 0s 0ms
Time for processing: 0h 0m 0s 2ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_5 

Time for processing: 0h 0m 0s 0ms
rescorediagonal /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_5_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_5_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_6 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_6 --sub-mat nucl:nucleotide.out,aa:blosum62.out --rescore-mode 3 --wrapped-scoring 0 --filter-hits 0 -e 1e-05 -c 0 -a 0 --cov-mode 0 --min-seq-id 0.97 --min-aln-len 0 --seq-id-mode 0 --add-self-matches 0 --sort-results 0 --db-load-mode 0 --threads 2 --compressed 0 -v 3 

[=================================================================] 100.00% 4 0s 0ms      
Time for merging to aln_6: 0h 0m 0s 0ms
Time for processing: 0h 0m 0s 1ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_5 

Time for processing: 0h 0m 0s 0ms
assembleresults /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_5_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_6 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_6 --min-seq-id 0.97 --max-seq-len 65535 --threads 2 -v 3 --rescore-mode 3 

Compute assembly.
[=================================================================] 100.00% 4 0s 0ms      
Time for merging to assembly_6: 0h 0m 0s 0ms

Done.
Time for processing: 0h 0m 0s 2ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_5_noneCycle 

Time for processing: 0h 0m 0s 0ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_5 

Time for processing: 0h 0m 0s 0ms
cyclecheck /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_6 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_6_cycle --max-seq-len 65535 --chop-cycle 1 --threads 2 -v 3 

Time for merging to assembly_6_cycle: 0h 0m 0s 0ms
Time for processing: 0h 0m 0s 0ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_5_cycle 

Time for processing: 0h 0m 0s 0ms
STEP: 7
kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_6_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_7 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 

kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_6_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_7 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 

Database size: 4 type: Nucleotide

Estimated memory consumption 0 MB
Generate k-mers list for 1 split
[=================================================================] 100.00% 4 0s 0ms      

Adjusted k-mer length 22
Sort kmer 0h 0m 0s 0ms
Sort by rep. sequence 0h 0m 0s 0ms
Time for fill: 0h 0m 0s 0ms
Time for merging to pref_7: 0h 0m 0s 0ms
Time for processing: 0h 0m 0s 1ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_6 

Time for processing: 0h 0m 0s 0ms
rescorediagonal /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_6_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_6_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_7 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_7 --sub-mat nucl:nucleotide.out,aa:blosum62.out --rescore-mode 3 --wrapped-scoring 0 --filter-hits 0 -e 1e-05 -c 0 -a 0 --cov-mode 0 --min-seq-id 0.97 --min-aln-len 0 --seq-id-mode 0 --add-self-matches 0 --sort-results 0 --db-load-mode 0 --threads 2 --compressed 0 -v 3 

[=================================================================] 100.00% 4 0s 0ms      
Time for merging to aln_7: 0h 0m 0s 0ms
Time for processing: 0h 0m 0s 1ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_6 

Time for processing: 0h 0m 0s 0ms
assembleresults /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_6_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_7 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_7 --min-seq-id 0.97 --max-seq-len 65535 --threads 2 -v 3 --rescore-mode 3 

Compute assembly.
[=================================================================] 100.00% 4 0s 0ms      
Time for merging to assembly_7: 0h 0m 0s 0ms

Done.
Time for processing: 0h 0m 0s 0ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_6_noneCycle 

Time for processing: 0h 0m 0s 0ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_6 

Time for processing: 0h 0m 0s 0ms
cyclecheck /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_7 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_7_cycle --max-seq-len 65535 --chop-cycle 1 --threads 2 -v 3 

Time for merging to assembly_7_cycle: 0h 0m 0s 0ms
Time for processing: 0h 0m 0s 2ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_6_cycle 

Time for processing: 0h 0m 0s 0ms
STEP: 8
kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_7_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_8 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 

kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_7_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_8 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 

Database size: 4 type: Nucleotide

Estimated memory consumption 0 MB
Generate k-mers list for 1 split
[=================================================================] 100.00% 4 0s 0ms      

Adjusted k-mer length 22
Sort kmer 0h 0m 0s 0ms
Sort by rep. sequence 0h 0m 0s 0ms
Time for fill: 0h 0m 0s 0ms
Time for merging to pref_8: 0h 0m 0s 0ms
Time for processing: 0h 0m 0s 1ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_7 

Time for processing: 0h 0m 0s 0ms
rescorediagonal /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_7_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_7_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_8 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_8 --sub-mat nucl:nucleotide.out,aa:blosum62.out --rescore-mode 3 --wrapped-scoring 0 --filter-hits 0 -e 1e-05 -c 0 -a 0 --cov-mode 0 --min-seq-id 0.97 --min-aln-len 0 --seq-id-mode 0 --add-self-matches 0 --sort-results 0 --db-load-mode 0 --threads 2 --compressed 0 -v 3 

[=================================================================] 100.00% 4 0s 0ms      
Time for merging to aln_8: 0h 0m 0s 0ms
Time for processing: 0h 0m 0s 1ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_7 

Time for processing: 0h 0m 0s 0ms
assembleresults /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_7_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_8 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_8 --min-seq-id 0.97 --max-seq-len 65535 --threads 2 -v 3 --rescore-mode 3 

Compute assembly.
[=================================================================] 100.00% 4 0s 0ms      
Time for merging to assembly_8: 0h 0m 0s 0ms

Done.
Time for processing: 0h 0m 0s 1ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_7_noneCycle 

Time for processing: 0h 0m 0s 0ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_7 

Time for processing: 0h 0m 0s 0ms
cyclecheck /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_8 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_8_cycle --max-seq-len 65535 --chop-cycle 1 --threads 2 -v 3 

Time for merging to assembly_8_cycle: 0h 0m 0s 0ms
Time for processing: 0h 0m 0s 1ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_7_cycle 

Time for processing: 0h 0m 0s 0ms
STEP: 9
kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_8_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_9 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 

kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_8_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_9 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 

Database size: 4 type: Nucleotide

Estimated memory consumption 0 MB
Generate k-mers list for 1 split
[=================================================================] 100.00% 4 0s 0ms      

Adjusted k-mer length 22
Sort kmer 0h 0m 0s 0ms
Sort by rep. sequence 0h 0m 0s 0ms
Time for fill: 0h 0m 0s 0ms
Time for merging to pref_9: 0h 0m 0s 0ms
Time for processing: 0h 0m 0s 1ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_8 

Time for processing: 0h 0m 0s 0ms
rescorediagonal /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_8_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_8_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_9 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_9 --sub-mat nucl:nucleotide.out,aa:blosum62.out --rescore-mode 3 --wrapped-scoring 0 --filter-hits 0 -e 1e-05 -c 0 -a 0 --cov-mode 0 --min-seq-id 0.97 --min-aln-len 0 --seq-id-mode 0 --add-self-matches 0 --sort-results 0 --db-load-mode 0 --threads 2 --compressed 0 -v 3 

[=================================================================] 100.00% 4 0s 0ms      
Time for merging to aln_9: 0h 0m 0s 0ms
Time for processing: 0h 0m 0s 2ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_8 

Time for processing: 0h 0m 0s 0ms
assembleresults /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_8_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_9 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_9 --min-seq-id 0.97 --max-seq-len 65535 --threads 2 -v 3 --rescore-mode 3 

Compute assembly.
[=================================================================] 100.00% 4 0s 0ms      
Time for merging to assembly_9: 0h 0m 0s 0ms

Done.
Time for processing: 0h 0m 0s 0ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_8_noneCycle 

Time for processing: 0h 0m 0s 0ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_8 

Time for processing: 0h 0m 0s 0ms
cyclecheck /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_9 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_9_cycle --max-seq-len 65535 --chop-cycle 1 --threads 2 -v 3 

Time for merging to assembly_9_cycle: 0h 0m 0s 0ms
Time for processing: 0h 0m 0s 1ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_8_cycle 

Time for processing: 0h 0m 0s 0ms
STEP: 10
kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_9_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_10 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 

kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_9_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_10 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 

Database size: 4 type: Nucleotide

Estimated memory consumption 0 MB
Generate k-mers list for 1 split
[=================================================================] 100.00% 4 0s 0ms      

Adjusted k-mer length 22
Sort kmer 0h 0m 0s 0ms
Sort by rep. sequence 0h 0m 0s 0ms
Time for fill: 0h 0m 0s 0ms
Time for merging to pref_10: 0h 0m 0s 0ms
Time for processing: 0h 0m 0s 1ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_9 

Time for processing: 0h 0m 0s 0ms
rescorediagonal /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_9_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_9_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_10 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_10 --sub-mat nucl:nucleotide.out,aa:blosum62.out --rescore-mode 3 --wrapped-scoring 0 --filter-hits 0 -e 1e-05 -c 0 -a 0 --cov-mode 0 --min-seq-id 0.97 --min-aln-len 0 --seq-id-mode 0 --add-self-matches 0 --sort-results 0 --db-load-mode 0 --threads 2 --compressed 0 -v 3 

[=================================================================] 100.00% 4 0s 0ms      
Time for merging to aln_10: 0h 0m 0s 0ms
Time for processing: 0h 0m 0s 1ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_9 

Time for processing: 0h 0m 0s 0ms
assembleresults /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_9_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_10 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_10 --min-seq-id 0.97 --max-seq-len 65535 --threads 2 -v 3 --rescore-mode 3 

Compute assembly.
[=================================================================] 100.00% 4 0s 0ms      
Time for merging to assembly_10: 0h 0m 0s 0ms

Done.
Time for processing: 0h 0m 0s 1ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_9_noneCycle 

Time for processing: 0h 0m 0s 0ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_9 

Time for processing: 0h 0m 0s 0ms
cyclecheck /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_10 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_10_cycle --max-seq-len 65535 --chop-cycle 1 --threads 2 -v 3 

Time for merging to assembly_10_cycle: 0h 0m 0s 0ms
Time for processing: 0h 0m 0s 1ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_9_cycle 

Time for processing: 0h 0m 0s 0ms
STEP: 11
kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_10_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_11 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 

kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_10_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_11 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 

Database size: 4 type: Nucleotide

Estimated memory consumption 0 MB
Generate k-mers list for 1 split
[=================================================================] 100.00% 4 0s 0ms      

Adjusted k-mer length 22
Sort kmer 0h 0m 0s 0ms
Sort by rep. sequence 0h 0m 0s 0ms
Time for fill: 0h 0m 0s 0ms
Time for merging to pref_11: 0h 0m 0s 0ms
Time for processing: 0h 0m 0s 1ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_10 

Time for processing: 0h 0m 0s 0ms
rescorediagonal /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_10_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_10_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_11 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_11 --sub-mat nucl:nucleotide.out,aa:blosum62.out --rescore-mode 3 --wrapped-scoring 0 --filter-hits 0 -e 1e-05 -c 0 -a 0 --cov-mode 0 --min-seq-id 0.97 --min-aln-len 0 --seq-id-mode 0 --add-self-matches 0 --sort-results 0 --db-load-mode 0 --threads 2 --compressed 0 -v 3 

[=================================================================] 100.00% 4 0s 0ms      
Time for merging to aln_11: 0h 0m 0s 0ms
Time for processing: 0h 0m 0s 2ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_10 

Time for processing: 0h 0m 0s 0ms
assembleresults /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_10_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_11 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_11 --min-seq-id 0.97 --max-seq-len 65535 --threads 2 -v 3 --rescore-mode 3 

Compute assembly.
[=================================================================] 100.00% 4 0s 0ms      
Time for merging to assembly_11: 0h 0m 0s 0ms

Done.
Time for processing: 0h 0m 0s 1ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_10_noneCycle 

Time for processing: 0h 0m 0s 0ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_10 

Time for processing: 0h 0m 0s 0ms
cyclecheck /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_11 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_11_cycle --max-seq-len 65535 --chop-cycle 1 --threads 2 -v 3 

Time for merging to assembly_11_cycle: 0h 0m 0s 0ms
Time for processing: 0h 0m 0s 0ms
rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_10_cycle 

Time for processing: 0h 0m 0s 0ms
Tmp /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/clu_tmp folder does not exist or is not a directory.
Create dir /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/clu_tmp
linclust /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_final /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/clu /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/clu_tmp --alph-size 5 -k 22 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --min-seq-id 0.97 --cov-mode 1 -c 0.99 --wrapped-scoring 1 

Set cluster mode GREEDY MEM.
kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_final /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/clu_tmp/8372675225677313391/pref --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 1 -k 22 -c 0.99 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 0 --ignore-multi-kmer 0 --threads 4 --compressed 0 -v 3 

kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_final /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/clu_tmp/8372675225677313391/pref --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 1 -k 22 -c 0.99 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 0 --ignore-multi-kmer 0 --threads 4 --compressed 0 -v 3 

Database size: 0 type: Nucleotide

Estimated memory consumption 0 MB
Time for fill: 0h 0m 0s 0ms
Time for merging to pref: 0h 0m 0s 0ms
Time for processing: 0h 0m 0s 1ms
rescorediagonal /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_final /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_final /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/clu_tmp/8372675225677313391/pref /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/clu_tmp/8372675225677313391/pref_rescore1 --sub-mat nucl:nucleotide.out,aa:blosum62.out --rescore-mode 0 --wrapped-scoring 1 --filter-hits 0 -e 0.001 -c 0.99 -a 0 --cov-mode 1 --min-seq-id 0.97 --min-aln-len 0 --seq-id-mode 0 --add-self-matches 0 --sort-results 0 --db-load-mode 0 --threads 4 --compressed 0 -v 3

Your Environment

Include as many relevant details about the environment you experienced the bug in.

  • Plass Version: 3.764a3
  • Conda package
  • Server specifications (especially CPU support for AVX2/SSE and amount of system memory): Tried on different systems with the same result. Intel(R) Xeon(R) CPU E5-2620 v4 @ 2.10GHz 64 GB RAM - Intel(R) Core(TM) i7-4510U CPU @ 2.00GHz 16 GB RAM
  • Operating system and version: Ubuntu 16.04
@martin-steinegger
Copy link
Member

@mr-eyes thanks for reporting this. This error seem to be fixed in the newest version of plass. Could you please retry it with the newest version?

@mr-eyes
Copy link
Author

mr-eyes commented May 26, 2020

@martin-steinegger I think I'm already using the latest release via bioconda channel latest_release.

@mr-eyes
Copy link
Author

mr-eyes commented May 26, 2020

@martin-steinegger I tried the latest static linux build and it's fixed, the version of it is the commit hash 63193c8d06e8876e652d4052fe30a0016a2e029a and it's working just fine. I'll use this one until releasing this version via conda.

Thank you,

@mr-eyes
Copy link
Author

mr-eyes commented May 27, 2020

UPDATE: The issue still exists if the number of reads is 1. It enters an infinite loop when trying to assemble a single read (Which logically makes sense) but the problem in the infinite loop.

@mr-eyes
Copy link
Author

mr-eyes commented May 28, 2020

Another noticed behavior regarding the multiprocessing, the internal clustering commands that runs at the end of the assembly to extract the representative sequences does not inherit the user-defined --threads. In an experiment, I run the assembly with --threads 32 but I found in the plass log the following line

clust --cluster-mode 3 --max-iterations 1000 --similarity-type 2 --threads 96 --compressed 0 -v 3

@AnnSeidel
Copy link
Member

@mr-eyes The nuclassemble workflow itself is heavily under development at the moment. I fixed the problem that the --threads value was not passed to the redundancy workflow in general. But I guess the clust --cluster-mode 3 --max-iterations 1000 --similarity-type 2 --threads 96 --compress line was part of your first run, right? Because I noticed some problems with the redundancy reduction itself some weeks ago and took that part out from the nuclassemble provisionally until it is fixed. So there should be no automatic redundancy reduction in the current version of the nuclassemble workflow. If you want to reduce redundancy for now, you can use mmseqs cluster.

@mr-eyes
Copy link
Author

mr-eyes commented May 28, 2020 •
edited

@AnnSeidel Actually not, my first run was --threads 32. And the plass version of the current two issues is 63193c8d06e8876e652d4052fe30a0016a2e029a.

Integrating the clustering at the end of the pipeline is nice, and it would not be a problem running mmseqs cluster manually after the run (I'm doing this in the meantime).

To summarize this thread, we have two issues here.

  1. Handling the case when the user tries to assemble just one read, this will cause plass to enter an infinite loop running on 24 threads.
  2. The inheritance of the user-defined --threads in the plass nuclassemble in the internal invocation of the other processes. (I didn't try the protein mode).

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment
Assignees
No one assigned
Labels
None yet
Projects
None yet
Milestone
No milestone
Development

No branches or pull requests
3 participants
@martin-steinegger @mr-eyes @AnnSeidel