Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Merge pull request #3068 from vgteam/allow-add-overlap
Pre-index non-alt paths to fix #3054
- Loading branch information
Showing
6 changed files
with
67 additions
and
11 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,24 @@ | ||
{ | ||
"node": [ | ||
{"id": 1, "sequence": "CTTAAAATGATCGGGACTTTTCAAATCTTATTT"} | ||
], | ||
"edge": [ | ||
], | ||
"path": [ | ||
{"name": "ref", "mapping": [ | ||
{"rank": 1, "edit": [ | ||
{"from_length": 33, "to_length": 33} | ||
], "position": {"node_id": 1, "offset": 0, "is_reverse": true}} | ||
]}, | ||
{"name": "ref2", "mapping": [ | ||
{"rank": 1, "edit": [ | ||
{"from_length": 33, "to_length": 33} | ||
], "position": {"node_id": 1, "offset": 0}} | ||
]}, | ||
{"name": "ref3", "mapping": [ | ||
{"rank": 1, "edit": [ | ||
{"from_length": 33, "to_length": 33} | ||
], "position": {"node_id": 1, "offset": 0, "is_reverse": true}} | ||
]} | ||
] | ||
} |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,15 @@ | ||
##fileformat=VCFv4.0 | ||
##fileDate=20090805 | ||
##source=myImputationProgramV3.1 | ||
##reference=1000GenomesPilot-NCBI36 | ||
##phasing=partial | ||
##FILTER=<ID=q10,Description="Quality below 10"> | ||
##FILTER=<ID=s50,Description="Less than 50% of samples have data"> | ||
##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype"> | ||
#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT SAMPLE1 SAMPLE2 SAMPLE3 SAMPLE4 | ||
ref 18 . TC T 100 PASS . GT 1/0 0/0 0|0 ././1 | ||
ref 21 . CGA GAC 100 PASS . GT 0/1 0/0 ./1 ./1/. | ||
ref 23 . A AC 100 PASS . GT 0/0 1/0 . ./0 | ||
ref3 18 . TC T 100 PASS . GT 1/0 0/0 0|0 ././1 | ||
ref3 21 . CGA GAC 100 PASS . GT 0/1 0/0 ./1 ./1/. | ||
ref3 23 . A AC 100 PASS . GT 0/0 1/0 . ./0 |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
f86e9eb
There was a problem hiding this comment.
Choose a reason for hiding this comment
The reason will be displayed to describe this comment to others. Learn more.
vg CI tests complete for merge to master. View the full report here.
16 tests passed, 0 tests failed and 0 tests skipped in 14164 seconds
f86e9eb
There was a problem hiding this comment.
Choose a reason for hiding this comment
The reason will be displayed to describe this comment to others. Learn more.
vg CI tests complete for branch v1.28.0. View the full report here.
16 tests passed, 0 tests failed and 0 tests skipped in 13921 seconds