-
Notifications
You must be signed in to change notification settings - Fork 192
VG RDF for Summarization graphs
The concept in this document was an exploration during the Japan NBDC/DBCLS BioHackathon 2019. Graph summarization should have helped to generate zoom levels for visualization. The idea was not further pursued but a concept to generate zooming levels of pangenome graphs is currently under implementation at https://github.com/graph-genome/component_segmentation. For an overview of the whole Pantograph
project, please go to https://graph-genome.github.io/.
Graph summarization introduces a new type of nodes and relations to existing vg data.
A first proposal is to introduce three new types
- vg:SummationNode
- vg:SummationStep
- vg:SummationPath
This is node with only topology i.e. how it connects to other vg:SummationNode
s
the second new piece is pointers to the nodes that it summarizes. A new predicate vg:summaryOf
could be minted for this.
Like normal VG RDF steps are the key link between paths and nodes. Here they
are only different in the type otherwise the structure is the same.
To give a quick way to find the Steps by an offset from the start of the path we can reuse
vg:position
These should have names and properties that link to existing paths. reusing vg:summaryOf
is an option.
@prefix vg:<http://biohackathon.org/resource/vg#> .
@prefix node: <http://example.org/vg/node/> .
@prefix path: <http://example.org/vg/path/> .
@prefix step: <http://example.org/vg/step/> .
@prefix rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#> .
summationnodelevel1:1 a vg:SummationNode ;
vg:length 64 ;
vg:summaryOf node:1 , node:2 ;
vg:linksForwardToForward summationnodelevel1:2 .
summationnodelevel1:2 a vg:SummationNode ;
vg:length 96 ;
vg:summaryOf node:3 , node:4 , node:5.
summationstep1:1 a vg:SummationStep ;
vg:rank 1 ;
vg:position 0 ;
vg:path summationpath:x_at_zoom_2 ;
vg:summaryOf path:x .
summationstep1:2 a vg:SummationStep ;
vg:position 64 ;
vg:rank 2 ;
vg:path summationpath:x_at_zoom_2 ;
vg:summaryOf path:x .
node:1 rdf:value "CAAATAAGGCTTGGAAATTTTCTGGAGTTCTA" .
node:2 rdf:value "TTATATTCCAACTCTCTGGTTCCTGGTGCTAT" .
node:3 rdf:value "GTGTAACTAGTAATGGTAATGGATATGTTGGG" .
node:4 rdf:value "CTTTTTTCTTTGATTTATTTGAAGTGACGTTT" .
node:5 rdf:value "GACAATCTATCACTAGGGGTAATGTGGGGAAA" .
step:x-1 vg:position 0 ;
a vg:Step ;
vg:rank 1 ;
vg:node node:1 ;
vg:path path:x .
step:x-2 vg:position 32 ;
a vg:Step ;
vg:rank 2 ;
vg:node node:2 ;
vg:path path:x .
step:x-3 vg:position 64 ;
a vg:Step ;
vg:rank 3 ;
vg:node node:3 ;
vg:path path:x .
step:x-4 vg:position 96 ;
a vg:Step ;
vg:rank 4 ;
vg:node node:4 ;
vg:path path:x .
step:x-5 vg:position 128 ;
a vg:Step ;
vg:rank 5 ;
vg:node node:5 ;
vg:path path:x .
node:1 vg:linksForwardToForward node:2 .
node:2 vg:linksForwardToForward node:3 .
node:3 vg:linksForwardToForward node:4 .
node:4 vg:linksForwardToForward node:5 .