updated README

README.md

@@ -2,25 +2,75 @@
 
 [![Build Status](https://secure.travis-ci.org/wwood/bioruby-ipcress.png)](http://travis-ci.org/wwood/bioruby-ipcress)
 
-Full description goes here
-
-Note: this software is under active development!
+bio-ipcress is a library for programmatically interacting with the In-silico PCR Experiment Simulation System (iPCRess), 
+available as part of the [http://www.ebi.ac.uk/~guy/exonerate/](exonerate) package.
 
 ## Installation
 
 ```sh
-    gem install bio-ipcress
+gem install bio-ipcress
 ```
+To run an ipcress, you must also have ipcress itself installed. 
 
 ## Usage
 
 ```ruby
-    require 'bio-ipcress'
+require 'bio-ipcress'
+
+primer_set = Bio::Ipcress::PrimerSet.new('GGTCACTGCTA','GGCTACCTTGTTACGACTTAAC')
+results = Bio::Ipcress.run(
+   primer_set, 
+   'test/data/Ipcress/Methanocella_conradii_16s.fa', 
+   {:min_distance => 2, :max_distance => 10000}) # optional parameters
+   #=> a set of Bio::Ipcress::Result objects (in this case containing 1, since there is only 1 amplification product) 
+
+results[0].product #=> "1422 bp (range 2-10000)" 
+results[0].target #=> "gi|335929284|gb|JN048683.1|:filter(unmasked) Methanocella conradii HZ254 16S ribosomal RNA gene, partial sequence"
+```
+
+A full anatomy of a parsed iPCRess result:
+
+    assert_equal 'AE12_pmid21856836_16S', res.experiment_name
+    assert_equal 'A B', res.primers
+    assert_equal 'gi|335929284|gb|JN048683.1|:filter(unmasked) Methanocella conradii HZ254 16S ribosomal RNA gene, partial sequence',
+      res.target
+    assert_equal '19/20 14/15', res.matches
+    assert_equal '502 bp (range 2-10000)', res.product
+    assert_equal 'forward', res.result_type
+    assert_equal 'AAACTTAAAGGAATTGGCGG', res.forward_matching_sequence
+    assert_equal 'AAACTYAAAKGAATTGRCGG', res.forward_primer_sequence
+    assert_equal 'CRTGTGTGGCGGGCA', res.reverse_primer_sequence
+    assert_equal 'CGTGTGTGGCGGGCA', res.reverse_matching_sequence
+    assert_equal 502, res.length
+    assert_equal 826, res.start
+    assert_equal 1, res.forward_mismatches
+    assert_equal 1, res.reverse_mismatches
+
+```
+** Message: Loaded [1] experiments
+
+Ipcress result
+--------------
+ Experiment: AE12_pmid21856836_16S   ## experiment_name
+    Primers: A B   ## primers
+     Target: gi|335929284|gb|JN048683.1|:filter(unmasked) Methanocella conradii HZ254 16S ribosomal RNA gene, partial sequence   ## target
+    Matches: 19/20 14/15   ## matches
+    Product: 502 bp (range 2-10000)   ## product
+Result type: forward   ## result_type
+
+...AAACTTAAAGGAATTGGCGG......................... # forward   ## forward_matching_sequence ('AAACTTAAAGGAATTGGCGG')
+   ||||| ||| |||||| |||-->
+5'-AAACTYAAAKGAATTGRCGG-3' 3'-CRTGTGTGGCGGGCA-5' # primers   ## forward_primer_sequence, reverse_primer_sequence
+                           <--| |||||||||||||
+..............................CGTGTGTGGCGGGCA... # revcomp   ## reverse_matching_sequence
+--
+ipcress: gi|335929284|gb|JN048683.1|:filter(unmasked) AE12_pmid21856836_16S 502 A 826 1 B 1313 1 forward   ## length (502), start (826), forward_mismatches (1), reverse_mismatches (1)
+-- completed ipcress analysis
 ```
 
 The API doc is online. For more code examples see the test files in
 the source tree.
-        
+
 ## Project home page
 
 Information on the source tree, documentation, examples, issues and
@@ -32,7 +82,7 @@ The BioRuby community is on IRC server: irc.freenode.org, channel: #bioruby.
 
 ## Cite
 
-If you use this software, please cite one of
+bio-ipcress is currently unpublished. However, if you use this software, perhaps you would like to cite ipcress itself, as well as BioRuby and Biogem 
 
 * [BioRuby: bioinformatics software for the Ruby programming language](http://dx.doi.org/10.1093/bioinformatics/btq475)
 * [Biogem: an effective tool-based approach for scaling up open source software development in bioinformatics](http://dx.doi.org/10.1093/bioinformatics/bts080)