settings.init

;COMMENTS BEGIN WITH ';' SYMBOL
;This is the settings file for selex_sim, a numerical simulation method for selex experiments
;The parameters for the simulation are specified in this file.


[general]
;This section specifies parameters that are general to the whole selex process

;Specify the type of molecules to be used for the simulation (DNA or RNA)
selex_type: DNA
;Specify the type of reference aptamer to be used (will not be used if aptamer_mode is 1)
reference_aptamer: GTACGACAGTCATCCTACAC
;Specify the aptamer mode for selex. 
;A mode of 0 means that the user will supply the sequence for the reference aptamer.
;A mode of 1 means that the program will pick a random sequence as reference aptamer
aptamer_mode: 0
;The length of the sequences in selex
sequence_length: 20
;The number of selex rounds
number_of_rounds: 40
;The name of the selex experiment. This specifies the names of the output files from the
;experiment
experiment_name: he4_loop
;The number of samples to be drawn from each round. This attempts to mimic the effects
; of sequencing data collected from real selex experiments
sampling_size: 1000
;This specifies whether the simulation results should be post-processed or not
;Post processing involves generating tables for the changes in total and unique sequence number
;changes in average distance
;changes in average distance for each affinity group
post_process: True

[selectionparams]
;This section specifies parameters for the selection step

;This specifies the number of target ligand sites
scale: 1000000
;This specifies the distance metric to be used for affinity estimation (hamming, basepair, or loop)
distance: loop
;This specifies the degree of stringency of the selectio step
stringency: -3

[amplificationparams]
;This section specifies parameters for the amplification step

;This specifies the number of PCR cycles per selex round
number_of_pcr: 15
;This specifies the average efficiency of polymerase per PCR cycle
pcr_efficiency: 0.85
;This specifies the average error rate of polymerase per nucleotide
pcr_error_rate: 0.000001