garbled fastq files after Filter and trim

[Danyang1111]

Hi,
I am testing the ITS sequencing data which are publicly available in NCBI Sequence Read Archive (SRA) under the BioProject ID PRJNA610042. Follow DADA2 ITS Pipeline Workflow (1.8).
The Primer F:TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG R:GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG
After the step Filter and trim, it outputs some fastq files with garbled characters. But I can still go for the following steps and get the taxonomic assignments.
Why is this happening? how to deal with it? if I want to check the filtered files, how to fix these garbled fastq files?

Thanks.

[benjjneb]

By default filterAndTrim(..., compress=TRUE), and so gzipped fastq files are being output irrespective of the filenames (and extensions) you are assigning to the filtered fastqs. The fastq input/output for dada2 (all taken from the ShortRead package) autodetects and uncompresses those file, so all works as expected. But if you open it in a plain text editor, it will look garbled since it is in a compressed format.

You can "fix" this by setting compress=FALSE, uncompressing the files yourself before viewing, or by viewing the files using something like zmore that will show you the uncompressed output.