Skip to content

HTTPS clone URL

Subversion checkout URL

You can clone with HTTPS or Subversion.

Download ZIP
Browse files

Text case from Kamil Slowikowski for Nexus bug just fixed

  • Loading branch information...
commit 475de4dea4fe06ff6e87e653c9a1da20a04609b5 1 parent 541f2b5
@peterjc peterjc authored
View
25 Tests/Nexus/codonposset.nex
@@ -0,0 +1,25 @@
+#NEXUS
+[MacClade 4.05 registered to Computational Biologist, University]
+
+
+BEGIN DATA;
+ DIMENSIONS NTAX=2 NCHAR=22;
+ FORMAT DATATYPE=DNA MISSING=? GAP=- ;
+MATRIX
+[ 10 20 ]
+[ . . ]
+
+Aegotheles AAAAAGGCATTGTGGTGGGAAT [22]
+Aerodramus ?????????TTGTGGTGGGAAT [13]
+;
+END;
+
+
+BEGIN CODONS;
+ CODONPOSSET * CodonPositions =
+ N: 1-10,
+ 1: 11-22\3,
+ 2: 12-22\3,
+ 3: 13-22\3;
+ CODESET * UNTITLED = Universal: all ;
+END;
View
12 Tests/output/test_AlignIO
@@ -135,6 +135,18 @@ Testing reading nexus format file Nexus/test_Nexus_input.nex with 1 alignments
Checking can write/read as 'stockholm' format
Checking can write/read as 'fasta' format
Checking can write/read as 'tab' format
+Testing reading nexus format file Nexus/codonposset.nex with 1 alignments
+ Alignment 0, with 2 sequences of length 22
+ AAAAAGGCATTGTGGTGGGAAT Aegotheles
+ ?????????TTGTGGTGGGAAT Aerodramus
+ Checking can write/read as 'clustal' format
+ Checking can write/read as 'nexus' format
+ Checking can write/read as 'phylip' format
+ Checking can write/read as 'phylip-relaxed' format
+ Checking can write/read as 'phylip-sequential' format
+ Checking can write/read as 'stockholm' format
+ Checking can write/read as 'fasta' format
+ Checking can write/read as 'tab' format
Testing reading stockholm format file Stockholm/simple.sth with 1 alignments
Alignment 0, with 2 sequences of length 104
UUAAUCGAGCUCAACACUCUUCGUAUAUCCUC-UCA...UGU AP001509.1
View
1  Tests/test_AlignIO.py
@@ -36,6 +36,7 @@
("fasta", 3, 1, 'GFF/multi.fna'), #Trivial nucleotide alignment
#Following example is also used in test_Nexus.py
("nexus", 9, 1, 'Nexus/test_Nexus_input.nex'),
+ ("nexus", 2, 1, 'Nexus/codonposset.nex'),
("stockholm", 2, 1, 'Stockholm/simple.sth'),
("stockholm", 6, 1, 'Stockholm/funny.sth'),
("phylip", 6, 1, 'Phylip/reference_dna.phy'),
Please sign in to comment.
Something went wrong with that request. Please try again.