This is a pipeline for processing duplex sequencing data without the use of a reference genome.
The pipeline was designed for use with the duplex method described in Kennedy et al. 2014, but the assumptions are relatively minimal, so you should be able to apply it to variants of the protocol.
Du Novo 2.0 and later are released under the AFL license, but includes code licensed under the MIT and GPLv2 licenses. See LICENSE.txt
for details.
The latest published version of Du Novo can be cited as:
Stoler N, Arbeithuber B, Povysil G, Heinzl M, Salazar R, Makova KD, Tiemann-Boege I, Nekrutenko A. 2020.
Family reunion via error correction: an efficient analysis of duplex sequencing data. BMC Bioinformatics 21, 96.
We created a comprehensive tutorial explaining all aspects of interactive use of Du Novo from within Galaxy.
The pipeline requires a Unix operating system and Python, version 3.6 at least (3.8 recommended). Linux is recommended. OS X and BSD may work, but are untested.
It also requires several standard Unix tools. It makes use of several coreutils utilities, but these should be installed by default on most Unix systems. Following is a list of other commands which must be available on your $PATH
. Version numbers in parentheses are what the software was tested with, but other versions likely work.:
To use align-families.py
's --aligner mafft
option, this command must be available on your $PATH
:
mafft
(v7.271 or v7.123b)
To use make-consensi.py
's --aligner biopython
option, you'll need to install BioPython. Version 1.75 or higher is preferred, but lower ones will also likely work.
To use the barcode error correction scripts baralign.sh
and correct.py
, the following module must be available from Python:
- networkx (2.4)
..and the following commands must be on your $PATH
:
bowtie
(1.2.1.1) (nothing below 1.1.2 is confirmed to work)bowtie-build
(1.2.1.1) (same)samtools
(0.1.18)
$ git clone --recursive https://github.com/galaxyproject/dunovo.git
$ cd dunovo
$ git checkout master
$ git submodule update --recursive
Click the release labeled "Latest" under the Releases section at the right of this page. Download the zip file (the "Source code (zip)" link) at the bottom, as well as kalign.zip
, utillib.zip
, ET.zip
, and bfx.zip
. Extract the first zip file, then unzip the other three into the extracted directory and name those directories kalign
, utillib
, ET
, and bfx
, respectively.
In the end, the organization and names of the three directories should look like this:
dunovo
├─kalign
├─utillib
├─ET
└─bfx
$ cd dunovo
$ make
The make
command is needed to compile the C modules and kalign. You need to be in the root source directory (where the file Makefile
is) before running the command.
To check for obvious problems with the installation, you can run:
$ tests/run.sh core
Successful results should look like
[script] ::: [input file]:
Files [test output] and [expected output] are identical
Anything else is a failure. This won't catch every installation problem, but it should check that the basics are working.
This example shows how to go from raw duplex sequencing data to the final duplex consensus sequences.
Your raw reads should be in reads_1.fastq
and reads_2.fastq
. And the scripts make-families.sh
, align-families.py
, make-consensi.py
, baralign.sh
, and correct.py
should be on your $PATH
.
-
Sort the reads into families based on their barcodes and split the barcodes from the sequence.
$ make-families.sh reads_1.fastq reads_2.fastq > families.tsv
-
(Optional) Correct errors in barcodes.
$ baralign.sh families.tsv refdir barcodes.sam $ correct.py families.tsv refdir/barcodes.fa barcodes.sam | sort > families.corrected.tsv
- If you performed this step, change
families.tsv
below tofamilies.corrected.tsv
. -
Do multiple sequence alignments of the read families.
$ align-families.py families.tsv > families.msa.tsv
-
Build duplex consensus sequences from the aligned families.
$ make-consensi.py --fastq-out 40 families.msa.tsv --dcs1 duplex_1.fq --dcs2 duplex_2.fq
See all options for a given command by giving it the --help
flag.
$ make-families.sh reads_1.fastq reads_2.fastq > families.tsv
This command will split the 12bp tag off each read, combine the tags from each pair of reads into a combined barcode, and sort them by it. The end result is a file (named families.tsv
above) listing read pairs, grouped by barcode. See the make-barcodes.awk
code for the details on the formation of the barcodes and the format.
Note: This step requires your FASTQ files to have exactly 4 lines per read (no multi-line sequences). 5' trimmed sequences of variable length are allowed. Also, in the output, the read sequence does not include the barcode or the 5bp constant sequence after it. You can customize the length of the barcode with the -t
option or the constant sequence with the -i
option.
$ baralign.sh families.tsv refdir barcodes.sam
$ correct.py families.tsv refdir/barcodes.fa barcodes.sam | sort > families.corrected.tsv
These commands takes the families.tsv
file produced in the previous step, "corrects"* the barcodes in it, and outputs a new version of families.tsv
with the new barcodes. It does this by aligning all barcodes to themselves, finding pairs of barcodes which differ by only a few edits. Grouping sets of related barcodes gives groups which are likely descended from the same original barcode, differing only because of PCR and/or sequencing errors. By default, only barcodes that differ by 1 edit are allowed. You can allow greater edit distances between barcodes with the --dist
option to correct.py
.
* "corrects" is in scare quotes because the algorithm isn't actually focused on finding the original barcode sequence. Its goal is instead to group together reads which are all descended from the same ancestor molecule, but now have different barcodes because of errors. It finds each group of related reads and replaces all their barcodes them with a single sequence, whether or not that's the actual, original sequence. This ensures that the downstream scripts recognize these reads as belonging to the same family.
- If you performed step 3, change families.tsv
below to families.corrected.tsv
.
$ align-families.py families.tsv > families.msa.tsv
This step aligns each family of reads, but it processes each strand separately. It can be parallelized with the --processes
option.
By default, this uses the Kalign2 multiple sequence alignment algorithm. Use --aligner mafft
to select MAFFT instead. Kalign2 is reccommended, as its results are of similar accuracy and it's 7-8x faster.
$ make-consensi.py --fastq-out 40 families.msa.tsv --dcs1 duplex_1.fq --dcs2 duplex_2.fq
This calls a consensus sequence from the multiple sequence alignments of the previous step. It does this in two steps: First, single-strand consensus sequences (SSCSs) are called from the family alignments, then duplex consensus sequences are called from pairs of SSCSs.
When calling SSCSs, by default 3 reads are required to successfully create a consensus from each strand (change this with --min-reads
). Quality filtering is done at this step by excluding bases below a quality threshold. By default, no base with a PHRED quality less than 20 will contribute to the consensus (change this with --qual
). If no base passes the threshold or there is no majority base, N
will be used.
The duplex consensus sequences are created by comparing the two SSCSs. For each base, if they agree, that base will be used. If they disagree, the IUPAC ambiguity code for the two bases will be used. Note that a disagreement between a base and a gap will result in an N
.
The output of this step is the duplex consensus sequences in FASTA format. To also output all single-strand consensus sequences (including those which didn't produce a duplex consensus), use the --sscs1
and --sscs2
options.
The reads will be printed in two files, one per paired-end mate, with this naming format:
>{barcode} {# reads in strand 1 family}-{# reads in strand 2 family}
e.g.
>TTGCGCCAGGGCGAGGAAAATACT 8-13
When the consensus-calling process doesn't have enough information to call a base, it inserts an N or another IUPAC ambiguity code. This can happen in several cases, like when the two single-strand consensus sequences disagree, the PHRED quality is low, or the ends of the reads were trimmed.
The script trimmer.py
in the bfx
directory was written to deal with these bases. It can trim the ends of reads when they contain too many N's or ambiguous bases, or filter out reads with too many of them, or both.
It's a good idea to apply trimmer.py
to at least remove sequence with a high density of ambiguous bases. This will result from any low-quality region or portion of the consensus where the raw reads were trimmed to different lengths:
$ trimmer.py --acgt --window 10 --thres 0.3 --min-length 50 duplex_1.fa duplex_2.fa duplex.filt_1.fa duplex.filt_2.fa
For an explanation of the arguments, see:
This command will trim any read with more than 3 N's in a 10 base window, removing all the sequence after the first N in the offending window:
$ trimmer.py --filt-bases N --window 10 --thres 0.3 consensus.fa > filtered.fa
If our reads are 251bp, we can add --min-length 251
to make it simply remove any of the reads that ever exceed the threshold:
$ trimmer.py --filt-bases N --window 10 --thres 0.3 --min-length 251 consensus.fa > filtered.fa
The --acgt
argument will filter on any non-ACGT base instead of just N's:
$ trimmer.py --acgt --window 10 --thres 0.3 consensus.fa > filtered.fa
The script also handles paired-end data, preserving pairs by removing both reads when any one of them needs to be filtered out:
$ trimmer.py --acgt --window 10 --thres 0.3 cons_1.fa cons_2.fa filtered_1.fa filtered_2.fa
Be aware that a known bug in Python when using the multiprocessing module makes it impossible to kill a running process with the Ctrl+C keyboard command. So if you run align-families.py
or make-consensi.py
in the foreground, you'll have to exit via Ctrl+Z to stop and background the job, then kill the process (e.g. $ kill %1
, if it's the only backgrounded job).