Skip to content

Latest commit

 

History

History
46 lines (39 loc) · 2.15 KB

PERsim.md

File metadata and controls

46 lines (39 loc) · 2.15 KB

PERsim tool help

PERsim (0.1-222-g9be2128)

Paired-end read simulator for Illumina reads.

PERsim generates paired-end reads of a given length for a region of interest in the genome:
 - insert size is modelled using a gaussian distribution.
 - read-through into the sequencing adapters is modelled.
 - sequencing errors are modelled using a simple uniform distribution.

Mandatory parameters:
  -roi <file>      Target region BED file (the corresponding reference genome is taken from the settings.ini file).
  -count <int>     Number of read pairs to generate.
  -out1 <file>     Forward reads output file in .FASTQ.GZ format.
  -out2 <file>     Reverse reads output file in .FASTQ.GZ format.

Optional parameters:
  -length <int>    Read length for forward/reverse reads.
                   Default value: '100'
  -ins_mean <int>  Library insert size mean value.
                   Default value: '200'
  -ins_stdev <int> Library insert size mean standard deviation.
                   Default value: '70'
  -error <float>   Base error probability (uniform distribution).
                   Default value: '0.01'
  -max_n <int>     Maximum number of N bases (from reference genome).
                   Default value: '5'
  -a1 <string>     Forward read sequencing adapter sequence (for read-through).
                   Default value: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTTA'
  -a2 <string>     Reverse read sequencing adapter sequence (for read-through).
                   Default value: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTC'
  -ref <file>      Reference genome FASTA file. If unset 'reference_genome' from the 'settings.ini' file is used.
                   Default value: ''
  -v               Enable verbose debug output.
                   Default value: 'false'

Special parameters:
  --help           Shows this help and exits.
  --version        Prints version and exits.
  --changelog      Prints changeloge and exits.
  --tdx            Writes a Tool Definition Xml file. The file name is the application name with the suffix '.tdx'.

PERsim changelog

PERsim 0.1-222-g9be2128

back to ngs-bits