What is underline within amino acid for CDR3? #1097
Unanswered
Theragen-Bio
asked this question in
Q&A
Replies: 1 comment
-
|
Hi, |
Beta Was this translation helpful? Give feedback.
0 replies
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment
-
I found the "" underline within amino acid for CDR3.
For example, the nucleotide sequence for CDR3 was TGCAGTCCCTACGGGCAGATACTACGAGCAGTACTTC,
the putative amino acid from mixcr was CSPYGQ_YYEQYF, however, in silico translation was quite different "CSPYGQILRAVL".
Are there any special meaning for ""?
Beta Was this translation helpful? Give feedback.
All reactions