-
Notifications
You must be signed in to change notification settings - Fork 59
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Merge branch 'jdaw/add-midstrand-bc-detection' into 'master'
DOR-678 Add midstrand support for single and double ended barcodes See merge request machine-learning/dorado!993
- Loading branch information
Showing
11 changed files
with
201 additions
and
3 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
2 changes: 2 additions & 0 deletions
2
tests/data/barcode_demux/double_end_variant/EXP-PBC096_midstrand.fasta
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,2 @@ | ||
>a6703fe8-baa2-4dbe-a2de-4b5b22acd99 | ||
TGTACTTCGTTCCAGTTGCATTATGCTGGTGCTGTTCGGATTCTGTGGTAACTTCCTATTAATGCCTTTCTGTTGGTGCTGATGTGCGGCGTCTGCTTGGGTGTTTAACCTCCAAAAATCGCCGGAAGGGGCCCCTGCCCACTGAAACCGTGGTTTGCGATTCCTGGCCCTGTCGCTGAAGAATACAGCATCGCCTTTGGTCACTGGGCGTAACTGGAGGGCAAAGGTACGCCGGAAGGAGAGTATATACGCGCTGGATACCGGCTGCTGCTGGAATTCGGTACGTGCCTGCCTGCGCTGGGAAGATAAGCAGGCCTTTGTCAGCCGTCGAACCGGCATAAGGATTTGGAAATGAAACGGCGGCGTCTTAAACACCGACCTACGATATAGGAAGGCGGATAAGACGCGACCGGCGTCACATCCGGCGCTAGCCGTAAATTCTATACAAAATTACCGCCGCTCCAGATCTCAAAGCAATGAGCTGTGAGAGTTCTGCGCATCAGCATCGTGGAATTCGCTGAATACCGATTCCAGTCATCCGGCTCATCAATCGGAAATGGGTGTCGCCTTCCACTTCTGCGTCATTAATCAGATACAGTTTTTCTGCGCTTTTGGCAAGAACTGTTCATAAACGCGACCGCCGCCGCGATCACCCTTGGTGCGTACTACACGCCGCGATGGCTTCATCCACCAGCTACCGCGTTACGCGATCGTCAAATACCCGGTTGACTCTTCAGGGATAATATTTTTGCGTCTGGCAACGGACGACCGATTGATTCCCAGGTATGGCGGCCCATAATCACGGGTTTATTTAAGGTGTTGCGTTTAAACCAGGCGAGATCGGCAGGCAGGTTCCACGGCGTATGGCGTTTTCCATGCCGATAACGCGATCTACCGCTAACGCCGCAATCAGACTGATCATTGAGATTTCCCGATAAAAAAAATTGTCACAACCACTATGCGTAAAGCGTAAACCGTCGTCGACTGGTGCGAGGATGATGTTGAGGTTAAACACCCAAACGGAGCGCCGCAATATCAGCACCAGCAAGAAGGTTAATAGGGAAACACGATAGAATCCGAACAGCACCAGCAATACGTAATATTGTACTTCGTTCCAGTTGCATTATGCTGGTGCTGTTCGGATTCTGTGGTAACTTCCTATTAATGCCTTTCTGTTGGTGCTGATGTGCGGCGTCTGCTTGGGTGTTTAACCTCCAAAAATCGCCGGAAGGGGCCCCTGCCCACTGAAACCGTGGTTTGCGATTCCTGGCCCTGTCGCTGAAGAATACAGCATCGCCTTTGGTCACTGGGCGTAACTGGAGGGCAAAGGTACGCCGGAAGGAGAGTATATACGCGCTGGATACCGGCTGCTGCTGGAATTCGGTACGTGCCTGCCTGCGCTGGGAAGATAAGCAGGCCTTTGTCAGCCGTCGAACCGGCATAAGGATTTGGAAATGAAACGGCGGCGTCTTAAACACCGACCTACGATATAGGAAGGCGGATAAGACGCGACCGGCGTCACATCCGGCGCTAGCCGTAAATTCTATACAAAATTACCGCCGCTCCAGATCTCAAAGCAATGAGCTGTGAGAGTTCTGCGCATCAGCATCGTGGAATTCGCTGAATACCGATTCCAGTCATCCGGCTCATCAATCGGAAATGGGTGTCGCCTTCCACTTCTGCGTCATTAATCAGATACAGTTTTTCTGCGCTTTTGGCAAGAACTGTTCATAAACGCGACCGCCGCCGCGATCACCCTTGGTGCGTACTACACGCCGCGATGGCTTCATCCACCAGCTACCGCGTTACGCGATCGTCAAATACCCGGTTGACTCTTCAGGGATAATATTTTTGCGTCTGGCAACGGACGACCGATTGATTCCCAGGTATGGCGGCCCATAATCACGGGTTTATTTAAGGTGTTGCGTTTAAACCAGGCGAGATCGGCAGGCAGGTTCCACGGCGTATGGCGTTTTCCATGCCGATAACGCGATCTACCGCTAACGCCGCAATCAGACTGATCATTGAGATTTCCCGATAAAAAAAATTGTCACAACCACTATGCGTAAAGCGTAAACCGTCGTCGACTGGTGCGAGGATGATGTTGAGGTTAAACACCCAAACGGAGCGCCGCAATATCAGCACCAGCAAGAAGGTTAATAGGGAAACACGATAGAATCCGAACAGCACCAGCAATACGTAATAT |
2 changes: 2 additions & 0 deletions
2
tests/data/barcode_demux/single_end/SQK-RBK114-96_midstrand.fasta
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,2 @@ | ||
>00681739-1170-486a-899c-f6546ca9222e | ||
GCCGATATTAACCAAAGTTCGGTGTCTTTGTGGTTTTCGCATTTATCGTGAAACGCTTTCGCGTTTTTCGTGCGCCGCTTGGGGCGACCACAGGTTCAATTTCAATATCCGCCAGCTCCAGTTCACGTCCCGTTTCACGAGCGAGAATCAATAGTTTACGCGCCACATCCATACCAGAAAGATCATCTCGCGGGTCCGGTTCGGTATAACCCATTTCCCGCGCCAGCGTGGTCGCCTCGGAGAACTGCCGATATTAACCAAAGTTCGGTGTCTTTGTGGTTTTCGCATTTATCGTGAAACGCTTTCGCGTTTTTCGTGCGCCGCTTGGGGCGACCACAGGTTCAATTTCAATATCCGCCAGCTCCAGTTCACGTCCCGTTTCACGAGCGAGAATCAATAGTTTACGCGCCACATCCATACCAGAAAGATCATCTCGCGGGTCCGGTTCGGTATAACCCATTTCCCGCGCCAGCGTGGTCGCCTCGGAGAACT |