Mock Communities

[MycoMap]

Running the following command:

ufits filter -i out.otu_table.txt -f out.cluster.otus.fa -b MADMOCK --mc MADMOCK.fq

It does not seem to be finding any of the mock community members.

[01:56:22 PM]: OS: linux2, 2 cores, ~ 4 GB RAM. Python: 2.7.12
[01:56:23 PM]: ufits v.0.7.4, USEARCH v9.2.64, VSEARCH v2.3.4
[01:56:23 PM]: Loading OTU table: out.otu_table.txt
[01:56:23 PM]: OTU table contains 6749 OTUs
[01:56:23 PM]: Mapping OTUs to Mock Community (USEARCH)
[01:57:30 PM]: Mock members not found: M00223:13:000000000-AM23G:1:2101:12547:14605, M00223:13:000000000-AM23G:1:1113:5080:11972, M00223:13:000000000-AM23G:1:2110:11421:22117, M00223:13:000000000-AM23G:1:1102:15523:10975, M00223:13:000000000-AM23G:1:1105:17595:13435,

---

etc, etc. etc.

---

M00223:13:000000000-AM23G:1:2113:9217:4330
[01:57:30 PM]: Sorting OTU table naturally
[01:57:31 PM]: Removing OTUs according to --min_reads_otu: (OTUs with less than 2 reads from all samples)
[01:57:31 PM]: Normalizing OTU table to number of reads per sample
[01:57:31 PM]: Index bleed, samples into mock: 2.820267%.
[01:57:31 PM]: Will use value of 2.900000% for index-bleed OTU filtering.
[01:57:32 PM]: Filtering OTU table down to 6730 OTUs
[01:57:32 PM]: Filtering valid OTUs

OTU Table filtering finished

OTU Table Stats: out.stats.txt
Sorted OTU table: out.sorted.txt
Final filtered: out.final.txt
Final binary: out.final.binary.txt
Filtered OTUs: out.filtered.otus.fa

[nextgenusfs]

The --mc flag is for passing a multi FASTA file of what sequences you put into the sample (i.e. spike-in control). From the headers, these look like FASTQ headers? So it should look something like this:

>Mock1
ATTCCAGAGGGAGAGATAGAGAGAT
>Mock2
TTTTCCGGCGCGCGCGCGAGAGAG
etc

Simplify your FASTA headers, perhaps an abbreviation of the species or a mock1, mock2, mock3 convention.

[MycoMap]

I was pointing to the FASTA contig file being created from step 1 containing all of the mock community reads, rather than the FASTA containing the original community. This can be closed.