pileup issue

[cnk113]

Hello,

I was trying to run pileup however I when I remove the --chromosomes it throws an error that I need to set it.
When I do set it get this error

[2022-03-17 13:16:25.009] [secedo] [info] Found 3 input files in 'MG2/'
[2022-03-17 13:16:25.010] [secedo] [trace] Allocating data structures...
[2022-03-17 13:16:27.047] [secedo] [warning] Could not jump to chromosome 0, position 0 in file "MG2/mg2_appended.bam"  ]   0.0%, 0/249
pileup: /home/chang/secedo/pileup.cpp:74: bool read_bam_file(uint16_t, uint32_t, uint32_t, uint32_t, uint32_t, uint32_t, uint32_t, uint32_t, BamTools::BamReader&, std::ofstream&, std::vector<std::vector<CellData> >*, std::vector<std::atomic<short unsigned int> >*, std::unordered_map<std::__cxx11::basic_string<char>, long unsigned int>*, std::atomic<long unsitd::vector<std::vector<CellData> >*, std::vector<std::atomic<shgned int>*): Assertion `al.IsProperPair()' failed.
Aborted (core dumped)

[danieldanciu]

Thank you for reporting the problem. I will look into it over the weekend and get back to you.

…

On Thu, 17 Mar 2022 at 21:19, Chang Kim ***@***.***> wrote: Hello, I was trying to run pileup however I when I remove the --chromosomes it throws an error that I need to set it. When I do set it get this error [2022-03-17 13:16:25.009] [secedo] [info] Found 3 input files in 'MG2/' [2022-03-17 13:16:25.010] [secedo] [trace] Allocating data structures... [2022-03-17 13:16:27.047] [secedo] [warning] Could not jump to chromosome 0, position 0 in file "MG2/mg2_appended.bam" ] 0.0%, 0/249 pileup: /home/chang/secedo/pileup.cpp:74: bool read_bam_file(uint16_t, uint32_t, uint32_t, uint32_t, uint32_t, uint32_t, uint32_t, uint32_t, BamTools::BamReader&, std::ofstream&, std::vector<std::vector<CellData> >*, std::vector<std::atomic<short unsigned int> >*, std::unordered_map<std::__cxx11::basic_string<char>, long unsigned int>*, std::atomic<long unsitd::vector<std::vector<CellData> >*, std::vector<std::atomic<shgned int>*): Assertion `al.IsProperPair()' failed. Aborted (core dumped) — Reply to this email directly, view it on GitHub <#19>, or unsubscribe <https://github.com/notifications/unsubscribe-auth/AAOYQLFUMVULTGKXNFQOBCTVAOHT5ANCNFSM5Q75SFEA> . Triage notifications on the go with GitHub Mobile for iOS <https://apps.apple.com/app/apple-store/id1477376905?ct=notification-email&mt=8&pt=524675> or Android <https://play.google.com/store/apps/details?id=com.github.android&referrer=utm_campaign%3Dnotification-email%26utm_medium%3Demail%26utm_source%3Dgithub>. You are receiving this because you are subscribed to this thread.Message ID: ***@***.***>

[danieldanciu]

Hi Chang - Sorry for the delayed reply. I looked into the error message a bit, and it seems to me that for some reason SECEDO was not able to index your BAM file. (it needs to create a bam.bai index file in order to be able to access it quickly). Could it be that the file system where the BAM file lies is not writeable by SECEDO? Daniel

…

On Fri, 18 Mar 2022 at 09:50, Daniel Danciu ***@***.***> wrote: Thank you for reporting the problem. I will look into it over the weekend and get back to you. On Thu, 17 Mar 2022 at 21:19, Chang Kim ***@***.***> wrote: > Hello, > > I was trying to run pileup however I when I remove the --chromosomes it > throws an error that I need to set it. > When I do set it get this error > > [2022-03-17 13:16:25.009] [secedo] [info] Found 3 input files in 'MG2/' > [2022-03-17 13:16:25.010] [secedo] [trace] Allocating data structures... > [2022-03-17 13:16:27.047] [secedo] [warning] Could not jump to chromosome 0, position 0 in file "MG2/mg2_appended.bam" ] 0.0%, 0/249 > pileup: /home/chang/secedo/pileup.cpp:74: bool read_bam_file(uint16_t, uint32_t, uint32_t, uint32_t, uint32_t, uint32_t, uint32_t, uint32_t, BamTools::BamReader&, std::ofstream&, std::vector<std::vector<CellData> >*, std::vector<std::atomic<short unsigned int> >*, std::unordered_map<std::__cxx11::basic_string<char>, long unsigned int>*, std::atomic<long unsitd::vector<std::vector<CellData> >*, std::vector<std::atomic<shgned int>*): Assertion `al.IsProperPair()' failed. > Aborted (core dumped) > > — > Reply to this email directly, view it on GitHub > <#19>, or unsubscribe > <https://github.com/notifications/unsubscribe-auth/AAOYQLFUMVULTGKXNFQOBCTVAOHT5ANCNFSM5Q75SFEA> > . > Triage notifications on the go with GitHub Mobile for iOS > <https://apps.apple.com/app/apple-store/id1477376905?ct=notification-email&mt=8&pt=524675> > or Android > <https://play.google.com/store/apps/details?id=com.github.android&referrer=utm_campaign%3Dnotification-email%26utm_medium%3Demail%26utm_source%3Dgithub>. > > You are receiving this because you are subscribed to this thread.Message > ID: ***@***.***> >

[cnk113]

I see, the index is already in the dir.
However I wanted to clarify if the input bam file can be a single one for multiple cells, where the cells are indicated by the CB BAM tag?
Or does all cells have to be split in individual bam files?

[danieldanciu]

Yes, the BAM files needs to be separated into 1 file per cell. This directory here: https://github.com/ratschlab/secedo-evaluation/tree/main/breast_cancer/preprocessing contains scripts that we used for preprocessing BAM files. The third step of the preprocessing (3_run_splittingByCB.sh <https://github.com/ratschlab/secedo-evaluation/blob/main/breast_cancer/preprocessing/3_run_splittingByCB.sh>) is splitting the BAM files by the CB tag. Daniel

…

On Tue, 22 Mar 2022 at 17:47, Chang Kim ***@***.***> wrote: I see, the index is already in the dir. However I wanted to clarify if the input bam file can be a single one for multiple cells, where the cells are indicated by the CB BAM tag? Or does all cells have to be split in individual bam files? — Reply to this email directly, view it on GitHub <#19 (comment)>, or unsubscribe <https://github.com/notifications/unsubscribe-auth/AAOYQLF7BLKQMKBBXTD2C43VBH2TNANCNFSM5Q75SFEA> . You are receiving this because you commented.Message ID: ***@***.***>

[danieldanciu]

I don't understand what the problem is. Can you elaborate?

…

On Tue, 24 May 2022 at 07:02, Jing LIU ***@***.***> wrote: I have the same issue with my already splitted bam files. I used the subset-bam <https://github.com/10XGenomics/subset-bam> from 10X to split the bam files into single cell bam files. My bam file looks like below: MGISEQ2000:1:V300070375:2:0647189:1:22 99 chr1 3005214 60 84M = 3005328 214 AGACTTCATAAATAGGTACAAAATATTACATGAAACACCAAATAATACACATCCTACCCTGCAGCATACAGAAACTTTTATAAA ;FDFFFFEFFFFFD>FF?EGFFFFFFFGDFFFFFFCGFGFFGEACGFFFDFFFFFFFFFFEFFFEFFDBFEFDFFAFFF;;GFF CB:Z:AAACGGGGTTTGTCTT-1 MD:Z:84 RG:Z:24mo_1_1 NM:i:0 GP:i:3005213 MP:i:3005427 CR:Z:AAACGGGGTTTGTCTT AS:i:84 XS:i:20 CY:Z:GF>FECFFGFGFFFFF Can you help? Thanks! — Reply to this email directly, view it on GitHub <#19 (comment)>, or unsubscribe <https://github.com/notifications/unsubscribe-auth/AAOYQLBO5S22YIJEXDJ6RZLVLRPFBANCNFSM5Q75SFEA> . You are receiving this because you commented.Message ID: ***@***.***>

[IamksGEEK]

Hello
I think Assertion al.IsProperPair()' failed` is caused by unfiltered data which include read pair which is not proper paired. You should filter your bam file with -f 524 first.