write_454
Martin Asser Hansen edited this page Oct 2, 2015
·
6 revisions
... | write_454 [options] -o <FASTA file> -q <QUAL file>
[-? | --help] # Print full usage description.
[-x | --no_stream] # Do not emit records.
[-o <file> | --data_out=<file>] # Write sequences to file.
[-q <file> | --qual_out=<file>] # Write quality scores to file.
[-I <file!> | --stream_in=<file!>] # Read input from stream file - Default=STDIN
[-O <file> | --stream_out=<file>] # Write output to stream file - Default=STDOUT
[-Z | --compress] # Compress output using gzip.
[-v | --verbose] # Verbose output.
To write the following entry to files:
SCORES: IIIIIIIFFC::::88AEIA@@>>BCCCC/////@99@A:9<;EIIIIIIIIIIIIIIIIIII
SEQ: ACGTCATGGGCAATCCTGAGCCAACTCATGGAAATGGATAGGTGCAGAGACTCAATGGCTGAC
SEQ_NAME: GG42H5Y01A9ZDB rank=0000022 x=406.5 y=2493.0 length=63
---
Do
... | write_454 -o test.fna -q test.qual -x
And obtain the two files with the content:
cat test.fna
>GG42H5Y01A9ZDB rank=0000022 x=406.5 y=2493.0 length=63
ACGTCATGGGCAATCCTGAGCCAACTCATGGAAATGGATAGGTGCAGAGACTCAATGGCTGAC
cat test.qual
>GG42H5Y01A9ZDB rank=0000022 x=406.5 y=2493.0 length=63
40 40 40 40 40 40 40 37 37 34 25 25 25 25 23 23 32 36 40 32 31
31 29 29 33 34 34 34 34 14 14 14 14 14 31 24 24 31 32 25 24 27
26 36 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40
[read_454]
Martin Asser Hansen - Copyright (C) - All rights reserved.
May 2010
GNU General Public License version 2
http://www.gnu.org/copyleft/gpl.html
[write_454] is part of the Biopieces framework.