Athena

Athena is a read cloud assembler for metagenomes.

Recent updates

• Conda: Athena is now available through bioconda. Please ensure channels are properly setup for bioconda before installing. Also, note you must create a new environment with conda create before installing as referenced in #14162

• v1.3 release: Updates to command-line arguments and logging.

Installation

To run Athena through a Docker image with Athena and its prerequisities already installed, please skip to section Docker (and example dataset).

To install Athena in your native environment, the following prerequisites must be installed:

• python 2.7 on Mac and Linux; Athena is not compatible with python 3.x
• idba_ud -- please use this version, which is modified both to handle longer short-read lengths and to locally assemble subsampled barcoded reads clouds. Ensure all compiled binaries, including idba_subasm, are in your $PATH
• samtools and htslib -- version 1.3 or later of samtools must all be in your $PATH
• bwa-mem
• flye -- version 2.3.1

We recommend setting up a virtualenv prior to installing Athena (or using virtualenvwrapper):

sudo pip install virtualenv
virtualenv athena_meta

Then, to install

cd /path/to/athena_meta
pip install .

To test that Athena is installed correctly, you can simply run athena-meta from the commandline, which should show help text without any error messages.

Running Athena

Overview:

1. Generate input seed contigs for Athena with metaspades/idba_ud. Align barcoded input reads to seed contigs with bwa.
2. Setup a config.json file, which specifies inputs to Athena
3. Run Athena

1. Generate inputs

Input read clouds must be specified as an uncompressed paired-end interleaved FASTQ, with the following tag information as in the example read pair below:

@NS500418:354:H27G3BGXY:3:12612:25572:11380	RG:Z:rg-1	BC:Z:GCCAATTCAAGTTT-1
TTCCATGTGGAAGTAGTTGTATTTGACGTAGCCCGCCATACCGTTTTCTGACATGAAGCGGTAATTCTCCTCAGAACCGTAGCCGGATACGGCCACCACCGTATGGGCCAACCTGTCATATCTGCTTGAGAAGGATTG
+
EEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE/EEEEEEEEEEEEEEEEEEE6EEAEEEEAEEEEEEEEEEEEEEAEEEEEEEEEEEEEAEEEEEE
@NS500418:354:H27G3BGXY:3:12612:25572:11380	RG:Z:rg-1	BC:Z:GCCAATTCAAGTTT-1
CACGTGGTCTGGCGGGTCTCGCGCCACCTCTGGTTCGCCGTGGCCCTAACGGACAAGGACGCTACTTTCATGAGAATGAAGGAGGATGCCATGCGTAACGGCCAGACAAAGCCCGGTTACAACCTCCAGAACGGCACCGAGAACCAGA
+
EEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE6EEEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEE6EEEEEEEEEEEEAEEE

The barcoded interleaved FASTQ must satisfy the following:

• For each barcoded read, there must be a tag (either BC or BX, but not both) specifying the barcode. Each barcode must also end with a '-' followed by an integer sample identifier.
• The query name line for each read can have mulitple tags, but these must be tab-delimited to be compatible with bwa mem specifying -C.
• The input FASTQ file must be barcode-sorted such that all reads with the same attached barcode appear in a contiguous block.

Run metaspades or idba_ud out of the box to assemble your input barcoded read clouds into seed contigs. An example using metaspades:

metaspades.py --12 /path/to/reads  -o /path/to/metaspades/out

Create a bwa index for the ouput short-read draft assembly. Then run bwa mem specifying -C, to pass the FASTQ tags through to the BAM, and -p, to specify that the paired-end FASTQ is interleaved:

bwa index /path/to/metaspades/out/contigs.fasta
bwa mem -C -p /path/to/metaspades/out/contigs.fasta /path/to/reads | samtools sort -o align-reads.metaspades-contigs.bam -
samtools index align-reads.metaspades-contigs.bam

Note that the resulting BAM must be position sorted and indexed.

2. Setup a configuration file

The configuration file is in the JSON format, and contains the following parts:

1. input_fqs: path to barcoded reads (FASTQ). Must be uncompressed interleaved paired end reads, which specify barcodes with the BC tag as specified above.
2. ctgfasta_path: path to seed contigs (FASTA), which must be bwa indexed
3. reads_ctg_bam_path: alignments of barcoded input reads to seed contigs (alignments must have BC tag with barcode information per read).
4. (optional) cluster_settings: cluster compute environment to be used to perform assembly if a batch queueing submission system is available. Athena manages the environment using ipython-cluster-helper

A minimal config.json file contains the following:

{
    "input_fqs": "/path/to/fq",
    "ctgfasta_path": "/path/to/seeds.fa",
    "reads_ctg_bam_path": "/path/to/reads_2_seeds.bam"
}

An example cluster_settings entry specifying a compute cluster contains the following:

{
    "cluster_settings": {
        "cluster_type": "IPCluster",
        "processes": 128,
        "cluster_options": {
            "scheduler": "slurm",
            "queue": "normal",
            "extra_params": {"mem":16}
        }
    }
}

scheduler may be any of the clusters supported by ipython-cluster-helper. Currently, these are Platform LSF ("lsf"), Sun Grid Engine ("sge"), Torque ("torque"), and SLURM ("slurm"). processes specifies the size of the job array to be used.

3. Run Athena

To check all prerequisites are installed, run athena-meta --check_prereqs.

To run a tiny test assembly to check that Athena is properly setup, run athena-meta --test.

To run Athena on an input dataset, run athena-meta --config /path/to/config.json.

Note that the athena-meta command will continue running until all steps have completed. athena-meta runs locally with a single thread by default, but can be run using multiple threads by specifying --threads. Please be aware that each thread can required up to 4Gb of memory during the subassembly step and so the number of threads should be adjusted accordingly. If the config file provided specifies a cluster environment, the athena-meta command itself can be run from a head node as it is itself a lightweight process.

The output assembled contigs will be placed in a subdirectory of the one config.json resides in (in this case /path/to/results/olc/athena.asm.fa.) Logging output for each step will also be in the subdirectory logs (in this case /path/to/logs), which can be used to debug in event of an error.

Docker (and example dataset)

A docker image is available for Athena. To download and run athena-meta on the example read clouds (~46MB), you can run the following commands:

# use 'curl -O' if you're on a mac without wget
wget https://storage.googleapis.com/gbsc-gcp-lab-bhatt-public/readclouds-l-gasseri-example.tar.gz

tar -xzf readclouds-l-gasseri-example.tar.gz

Assuming docker is installed, the following command can be used to assemble the example read clouds from within docker (make sure you are in the same directory where you downloaded and extracted readclouds-meta-asm-example.tar.gz):

docker run -v `pwd`:/data -w /data/readclouds-l-gasseri-example abishara/athena-meta-flye-docker athena-meta --config config.json

This requires ~16GB of memory to run (for overlap assembly) and will take ~20 minutes to complete. If you are running docker for Mac, please make sure that your docker client has access to at least 16GB of memory (you may need to set in Preferences).

The output can be found in native host directory of readclouds-meta-asm-example.

Citing Athena

Please cite the following publication:

• A. Bishara and E. Moss, et al. High-quality genome sequences of uncultured microbes by assembly of read clouds. Nature Biotechnology 2018 (https://doi.org/10.1038/nbt.4266).

Troubleshooting

The athena-meta command may be run multiple times to resume from the last step successfully completed.

If you are having trouble installing or running Athena, the docker file (see above) may help you diagnose the issue.

If an error arises, the output from athena-meta or the log files may be informative.

ShortSequence: Sequence is too long. If you get this error during assembly, please make sure you are using the right fork of idba_ud.

Please submit issues on the github page for Athena.