Residual Encoder-Decoder Network for RNA Secondary Structure Prediction. This repository contains the source code for REDfold from the paper "REDfold: Accurate RNA Secondary Structure Prediction using Residual Encoder-Decoder Network". Please cite the paper if you use our source code or data.
The users are welcome to use REDfold webserver available at https://redfold.ee.ncyu.edu.tw for RNA structure prediction. REDfold is implemented in Python code and the cross-platform compatible program can be installed through the wheel package. It can predict the RNA secondary structure based on the RNA sequences.
python (>=3.7)
biopython (>=1.79)
numpy (>=1.21)
pandas(>=1.3.5)
scipy (>=1.7.3)
torch (>=1.9+cu111)
REDfold can be installed through the wheel package.
% pip install redfold-1.14a0-py2.py3-none-any.whl
REDfold can predict the RNA secondary structure with fasta-formatted RNA sequences.
% redfold directory_containing_fasta_files
>D00002586
GCUCGCGUGGCGUAAUGGCAACGCGUCUGACUUCUAAUCAGAAGAUUAUGGGUUCGACCCCCAUCGUGAGUG
(((((((..((((.......)))).(((((.......))))).....(((((.......)))))))))))).
REDfold can train the parameters with BPSEQ-formatted RNA sequences.
% redfold -train directory_containing_bpseq_files
REDfold web server is available at https://redfold.ee.ncyu.edu.tw
Chen, Chun-Chi, and Yi-Ming Chan. "REDfold: Accurate RNA Secondary Structure Prediction using Residual Encoder-Decoder Network." BMC Bioinformatics (2023).