v1.2.0 does not work with FASTA files

[kmnip]

ntCard version 1.2.0 histograms for FASTA and FASTQ files are different.
I think there is a bug in parsing FASTA files.
Here is an example:

test.fasta

>1
CACACACACAAAATCAGTACGTAGCTGATCGTACGATCGTACGATCGTAGCTAGCTAGCTGATGCTAGCTGACTGATCGTAGCTATGTAGCTGATCGATCGTGATCGATCGTACGTAGCTGATGATCGTACGTAGCTAGCTAGCTGATCGATCGATCGTACGTACGTACGTAGTCGATCGTA

histogram:

F1      0
F0      0
1       9223372036854775808
2       9223372036854775808
3       9223372036854775808
4       9223372036854775808
...

test.fastq

@1
CACACACACAAAATCAGTACGTAGCTGATCGTACGATCGTACGATCGTAGCTAGCTAGCTGATGCTAGCTGACTGATCGTAGCTATGTAGCTGATCGATCGTGATCGATCGTACGTAGCTGATGATCGTACGTAGCTAGCTAGCTGATCGATCGATCGTACGTACGTACGTAGTCGATCGTA
+1
11111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111

histogram:

F1      158
F0      128
1       128
2       0
3       0
4       0
...

[hmohamadi]

The old version works.

./ntcard -k25 -p test test.fa

F1      158
F0      128
1       128
2       0
3       0
4       0
5       0
6       0

Found the error in new version. seq should be line.

[jwcodee]

@hmohamadi yup, that is correct. I'm suprised the old one didnt fail given that I only changed if the if condition for function. Never mind, I broke the code. Shouldn't copy and paste

[hmohamadi]

@jowong4 in FASTA processing I designed it to read multiline FASTA records. So we have line which can be multiple seq.

[jwcodee]

Fixed in 8ebca4a. Thanks @hmohamadi .