Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Jump to bottom

Fix PCR bug (issue #279). #378

Merged
merged 1 commit into from
Sep 26, 2023
Merged

Fix PCR bug (issue #279). #378

Show file tree
Hide file tree
Changes from all commits
Commits
Show all changes
1 commit
Select commit
File filter

Filter by extension

Filter by extension
Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
2 changes: 1 addition & 1 deletion primers/pcr/pcr.go
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -178,7 +178,7 @@ func Simulate(sequences []string, targetTm float64, circular bool, primerList []

func generatePcrFragments(sequence string, forwardLocation int, reverseLocation int, forwardPrimerIndxs []int, reversePrimerIndxs []int, minimalPrimers []string, primerList []string) []string {
var pcrFragments []string
for forwardPrimerIndex := range forwardPrimerIndxs {
for _, forwardPrimerIndex := range forwardPrimerIndxs {
minimalPrimer := minimalPrimers[forwardPrimerIndex]
fullPrimerForward := primerList[forwardPrimerIndex]
for _, reversePrimerIndex := range reversePrimerIndxs {
Expand Down
17 changes: 17 additions & 0 deletions primers/pcr/pcr_test.go
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -2,6 +2,8 @@ package pcr

import (
"testing"

"github.com/google/go-cmp/cmp"
)

// gene is a gene for testing PCR
Expand Down Expand Up @@ -72,3 +74,18 @@ func TestSimulateConcatemerization(t *testing.T) {
t.Errorf("Should have gotten concatemerization")
}
}

// Test to catch bug discovered by @Koeng101, see issue #279.
func TestIssue279PCRBug(t *testing.T) {
gene := "aataattacaccgagataacacatcatggataaaccgatactcaaagattctatgaagctatttgaggcacttggtacgatcaagtcgcgctcaatgtttggtggcttcggacttttcgctgatgaaacgatgtttgcactggttgtgaatgatcaacttcacatacgagcagaccagcaaacttcatctaacttcgagaagcaagggctaaaaccgtacgtttataaaaagcgtggttttccagtcgttactaagtactacgcgatttccgacgacttgtgggaatccagtgaacgcttgatagaagtagcgaagaagtcgttagaacaagccaatttggaaaaaaagcaacaggcaagtagtaagcccgacaggttgaaagacctgcctaacttacgactagcgactgaacgaatgcttaagaaagctggtataaaatcagttgaacaacttgaagagaaaggtgcattgaatgcttacaaagcgatacgtgactctcactccgcaaaagtaagtattgagctactctgggctttagaaggagcgataaacggcacgcactggagcgtcgttcctcaatctcgcagagaagagctggaaaatgcgctttcttaa"

fragments, err := Simulate([]string{gene}, 55.0, false, []string{"TATATGGTCTCTTCATTTAAGAAAGCGCATTTTCCAGC", "TTATAGGTCTCATACTAATAATTACACCGAGATAACACATCATGG", "CTGCAGGTCGACTCTAG"})
if err != nil {
t.Fatalf("unexpected error during PCR simulation: %v", err)
}

want := "TTATAGGTCTCATACTAATAATTACACCGAGATAACACATCATGGATAAACCGATACTCAAAGATTCTATGAAGCTATTTGAGGCACTTGGTACGATCAAGTCGCGCTCAATGTTTGGTGGCTTCGGACTTTTCGCTGATGAAACGATGTTTGCACTGGTTGTGAATGATCAACTTCACATACGAGCAGACCAGCAAACTTCATCTAACTTCGAGAAGCAAGGGCTAAAACCGTACGTTTATAAAAAGCGTGGTTTTCCAGTCGTTACTAAGTACTACGCGATTTCCGACGACTTGTGGGAATCCAGTGAACGCTTGATAGAAGTAGCGAAGAAGTCGTTAGAACAAGCCAATTTGGAAAAAAAGCAACAGGCAAGTAGTAAGCCCGACAGGTTGAAAGACCTGCCTAACTTACGACTAGCGACTGAACGAATGCTTAAGAAAGCTGGTATAAAATCAGTTGAACAACTTGAAGAGAAAGGTGCATTGAATGCTTACAAAGCGATACGTGACTCTCACTCCGCAAAAGTAAGTATTGAGCTACTCTGGGCTTTAGAAGGAGCGATAAACGGCACGCACTGGAGCGTCGTTCCTCAATCTCGCAGAGAAGAGCTGGAAAATGCGCTTTCTTAAATGAAGAGACCATATA"
if diff := cmp.Diff(fragments[0], want); diff != "" {
t.Errorf("incorrect PCR output (-want,+got): %s", diff)
}
}
Loading