SPOA is a C++ library for fast alignment and consensus generation of closely related sequences, especially used for long, error-containing reads from third generation sequencers. It allows local, global, and semi-global (overlap) alignment, using linear, affine, or convex gap penalties, and can also weight by quality scores. SPOAR is an R wrapper for SPOA.
Get the latest stable R
release from
CRAN. Then install spoar
using from
Bioconductor the following code:
if (!requireNamespace("BiocManager", quietly = TRUE)) {
install.packages("BiocManager")
}
BiocManager::install("spoar")
And the development version from GitHub with:
BiocManager::install("brendanf/spoar")
Here is the first basic example from the SPOR README:
library("spoar")
sequences <- c(
"CATAAAAGAACGTAGGTCGCCCGTCCGTAACCTGTCGGATCACCGGAAAGGACCCGTAAAGTGATAATGAT",
"ATAAAGGCAGTCGCTCTGTAAGCTGTCGATTCACCGGAAAGATGGCGTTACCACGTAAAGTGATAATGATTAT",
"ATCAAAGAACGTGTAGCCTGTCCGTAATCTAGCGCATTTCACACGAGACCCGCGTAATGGG",
"CGTAAATAGGTAATGATTATCATTACATATCACAACTAGGGCCGTATTAATCATGATATCATCA",
"GTCGCTAGAGGCATCGTGAGTCGCTTCCGTACCGCAAGGATGACGAGTCACTTAAAGTGATAAT",
"CCGTAACCTTCATCGGATCACCGGAAAGGACCCGTAAATAGACCTGATTATCATCTACAT"
)
spoaAlign(sequences)
#> [1] "CATAAAAGAACG------T---------AGGTCGCCCGTCCGTAACC-T-GTCG-G-ATCACCGG-AA-A--G-G--A-CC-CGTAAAGTGATAATGAT-------------"
#> [2] "------------------------ATAAAGGCAGTCGCTCTGTAAGC-T-GTCG-A-TTCACCGGAAAGATGGCGTTA-CCACGTAAAGTGATAATGATTAT----------"
#> [3] "-ATCAAAGAACG------T-----------GTAGCCTGTCCGTAATC-T-AGCGCATTTCACACG--AGA---C-----CCGCGTAATGGG---------------------"
#> [4] "------------CGTAAAT---------AGGTAAT-GAT-TATCAT--T-A-C--ATATCACAAC--T-A--G-G----GC-CGT-AT-TAATCATGA-TATCATCA-----"
#> [5] "-------------------GTCGC-TAGAGGCA-T-CGTGAGTC-GC-T--TCC-G--T-ACCGCAAGGATGACG--AGTCACTTAAAGTGATAAT----------------"
#> [6] "---------------------------------------CCGTAACCTTCATCG-G-ATCACCGG-AA-A--G-G--A-CC-CGTAAA-TAGACCTGATTATCATC-TACAT"
spoaConsensus(sequences)
#> [1] "CATCAAAGAACGTAGGTAGCCCGTCCGTAACCTGTCGGATCACCGGAAAGAGGACCCGTAAAGTGATAATGATTATCATCTACAT"
Below is the citation output from using citation('spoar')
in R. Please
run this yourself to check for any updates on how to cite spoar.
print(citation("spoar"), bibtex = TRUE)
#>
#> Furneaux B, Vaser R (2021). _SPOAR: SIMD Partial Order Alignment in R_.
#> doi: 10.18129/B9.bioc.spoar (URL:
#> https://doi.org/10.18129/B9.bioc.spoar),
#> https://github.com/brendanf/spoar/spoar - R package version 0.99.3,
#> <URL: http://www.bioconductor.org/packages/spoar>.
#>
#> A BibTeX entry for LaTeX users is
#>
#> @Manual{,
#> title = {SPOAR: SIMD Partial Order Alignment in R},
#> author = {Brendan Furneaux and Robert Vaser},
#> year = {2021},
#> url = {http://www.bioconductor.org/packages/spoar},
#> note = {https://github.com/brendanf/spoar/spoar - R package version 0.99.3},
#> doi = {10.18129/B9.bioc.spoar},
#> }
#>
#> Vaser R, Sović I, Nagaranjan N, Šikić M (2017). "Fast and accurate de
#> novo genome assembly from long uncorrected reads." _Genome Research_,
#> *27*, 737-746. doi: 10.1101/gr.214270.116 (URL:
#> https://doi.org/10.1101/gr.214270.116), <URL:
#> https://doi.org/10.1101/gr.214270.116>.
#>
#> A BibTeX entry for LaTeX users is
#>
#> @Article{,
#> title = {Fast and accurate de novo genome assembly from long uncorrected reads},
#> author = {Robert Vaser and Ivan Sović and Niranjan Nagaranjan and Mile Šikić},
#> year = {2017},
#> journal = {Genome Research},
#> volume = {27},
#> issue = {5},
#> pages = {737--746},
#> doi = {10.1101/gr.214270.116},
#> url = {https://doi.org/10.1101/gr.214270.116},
#> }
Please note that the spoar
was only made possible thanks to many other
R and bioinformatics software authors, which are cited either in the
vignettes and/or the paper(s) describing this package.
Please note that the spoar
project is released with a Contributor
Code of Conduct. By
contributing to this project, you agree to abide by its terms.
- Continuous code testing is possible thanks to GitHub actions through usethis, remotes, and rcmdcheck customized to use Bioconductor’s docker containers and BiocCheck.
- Code coverage assessment is possible thanks to codecov and covr.
- The documentation website is automatically updated thanks to pkgdown.
- The code is styled automatically thanks to styler.
- The documentation is formatted thanks to devtools and roxygen2.
For more details, check the dev
directory.
This package was developed using biocthis.