Annotation file

[ShrutiKetan]

Annotation file
After maxbin, the binned files were concatenated into one to be an input file for Vizbin. Headers being contig ids. (eg >k123, >k99, etc)
Annotation file was made starting with labels as the first line and then 1-11 as categorical variables. But after multiple tries, it still gives just blue and red color. Can you please help me figure it out ?

Thank you very much

[claczny]

HI @ShrutiKetan,

could you please paste the first 20-or-so lines of your annotation file?

Thank you!

[ShrutiKetan]

Yes, sure. 1. annotation file label 001 001 001 001 001 001 001 001 001 001 001 001 001 001 001 001 001 001 001 2. contig.fasta

k91_90

TCGATATATCCAACCCACGACTAATACATATACCGCTAGCGACACAAATGGATACCATACTTCGAAAATG GTGAGTACTCGTTCTTCTAGGTCAAGACACTACTCAATCCTGTTATCGTAGTTGATGCAATCATTTTTCT CGCACCTCTTCTCTACACTCAGACGCTTGCCGAAGATCCAACCGTTCCACGAGTTGTTGATTCTTTACAG CTTTTCTCTGAAGTTGTCTCACATCCATTACTCTCACGAGCCTCGATTGTGCTATTCTTGAATAAGCTCG ATCTTACTGCTCGCGCTATCAAACAGGGAAAACGAGTCTCCGATTACTTAAGAGGTTATCCGAAGGATGA AAGTGAAAATAATATTTCAAGTCTTGTTAAAGGTAGATCAAAGTTCATCATGTTCGATACCTCATGACTA ACGTCATCTCTTTCAGCTTTTCGAACAAAGTACAAATCTATCTACAAGACCCTTTCACCCCCTCACAGGA TGTTCTTTTGCCATGAAACAAGCGTAATCGATTCAAA

k91_113

CTTTTACAGAAACTTACATAAATTCAGGAATATAACGGCATCTTTGGGGAATAACACGCCATCAATGATT TCGTCTTTGGACATCGCGTGGGGTAGACCAAGTGGACCAACAGGTCTGAATCGACTGCACTAAATTAACA CATCAGCTTTTGCATGCTGACTACATTACTATGACTATACCTCTTGAATTACGGCCTGTGTATACGGTAG ATTAGGTAAGTCTTCCCATTGTGGAACCCTGTCCGAGCCGATAACACGATCAATCTCTTCTTGAGCCTTT CGCTGCACATCAGGATGACACGCGAGAACTAGAATGGCGCTTTGCAGGGTGGCTGAAGACGTGTCTGAAC CCTCCAAAAGCACACCTCCGAGGTTGCTTGTTCTCACATCAGAAAATAGGCGCGGATTTGGTAAAAAGAT GCTTACAATAAATGCTCGCGGCTAGTAAGCCCCCATTCGTTTGAATTTTTGATTGCCTGCTCCATGAAAC AGCCGTTGCCCATATTTTTCTCGAGTCTTTTCTCGACATGTTCTAGAAGACGTCCGTAAAGCTTCTCATG GAGAGCTATTACCCTCTTTATTTGTCGTTTCCATTTGGCC Thank you for the prompt reply. Regards, Shruti Kutmutia B3, SCELSE

…

________________________________________ From: Cedric Laczny [notifications@github.com] Sent: Thursday, April 25, 2019 3:18 PM To: claczny/VizBin Cc: Kutmutia Shruti Ketan; Mention Subject: Re: [claczny/VizBin] Annotation file (#42) HI @ShrutiKetan<https://github.com/ShrutiKetan>, could you please paste the first 20-or-so lines of your annotation file? Thank you! — You are receiving this because you were mentioned. Reply to this email directly, view it on GitHub<#42 (comment)>, or mute the thread<https://github.com/notifications/unsubscribe-auth/AL5ILK3T4VKRY7VLZJJ6XBTPSFLLDANCNFSM4HIKLGTQ>.

________________________________ CONFIDENTIALITY: This email is intended solely for the person(s) named and may be confidential and/or privileged. If you are not the intended recipient, please delete it, notify us and do not copy, use, or disclose its contents. Towards a sustainable earth: Print only when necessary. Thank you.

[claczny]

Hmmm... 🤔

The first lines look about right...

Some thoughts:

• Is the number of lines in the annotation files equal to number-of-contigs-in-contig-fa + 1?
• If you do something like echo annotation.csv | sort | uniq, how many entries do you see? I would expect:

001
002
003
...
...
011
label

• Are all your contigs >= minimum length you specify in VizBin (default: >= 1,000 nt)?
• If you right-click in the visualization and show the legend, what do you see there? This should list 001, 002, ..., 011 in your case.

Alternatively, I would be happy to have a look at your files, if it would be possible for you to share them confidentially.

Best,

Cedric

[ShrutiKetan]

Hi Cedric, 1. Yes the number of lines in annotation file is no. of contigs + 1 2. uniq -c annotation.list 1 label 32444 001 79694 002 37980 003 22250 004 61323 005 22297 006 70103 007 105050 008 23495 009 12560 010 11892 011 Are all your contigs >= minimum length you specify in VizBin (default: >= 1,000 nt)? About this, not really! I have varied lengths. I am sorry i assumed than Vizbin would just ignore contigs below the set threshold. I have attached an image of what i see in the visualization window. Regards, Shruti Kutmutia B3, SCELSE

…

________________________________________ From: Cedric Laczny [notifications@github.com] Sent: Thursday, April 25, 2019 4:55 PM To: claczny/VizBin Cc: Kutmutia Shruti Ketan; Mention Subject: Re: [claczny/VizBin] Annotation file (#42) Hmmm... 🤔 The first lines look about right... Some thoughts: * Is the number of lines in the annotation files equal to number-of-contigs-in-contig-fa + 1? * If you do something like echo annotation.csv | sort | uniq, how many entries do you see? I would expect: 001 002 003 ... ... 011 label * Are all your contigs >= minimum length you specify in VizBin (default: >= 1,000 nt)? * If you right-click in the visualization and show the legend, what do you see there? This should list 001, 002, ..., 011 in your case. Alternatively, I would be happy to have a look at your files, if it would be possible for you to share them confidentially. Best, Cedric — You are receiving this because you were mentioned. Reply to this email directly, view it on GitHub<#42 (comment)>, or mute the thread<https://github.com/notifications/unsubscribe-auth/AL5ILK652ZFQKALQJE5ZJKDPSFWXVANCNFSM4HIKLGTQ>.

________________________________ CONFIDENTIALITY: This email is intended solely for the person(s) named and may be confidential and/or privileged. If you are not the intended recipient, please delete it, notify us and do not copy, use, or disclose its contents. Towards a sustainable earth: Print only when necessary. Thank you.

[claczny]

Are all your contigs >= minimum length you specify in VizBin (default: >= 1,000 nt)? About this, not really! I have varied lengths. I am sorry i assumed than Vizbin would just ignore contigs below the set threshold.

VizBin does ignore contigs below the threshold. However, when using an annotation file, the sequences are ignored, but not the respective annotations. This could be improved for sure in VizBin.

Hence, your issue might be due to this.
To overcome this, you might

1. filter the individual MaxBin bins according to length (e.g., >= 1,000 nt)
2. create per-bin annotation files, i.e., containing you categorical label (no header) as often as there are sequences in the filtered bin
3. concatenate the filtered bins -> contigs.size_selected.fa
4. concatenate the annotation files -> annotation.csv
5. put a "label" header into annotation.csv

I have attached an image of what i see in the visualization window.

I could unfortunately not see it attached. I assume this is because you replied via email and maybe GitHub's Issue system does not support this. Feel free to add the image to this issue (#42).

Depending on the size of contig.fa you might also give BusyBee Web a try. It complements some of the shortcomings of VizBin, it is web-based and thus has no user-level dependencies, but it provides less flexibility and has a maximum upload limit.

Hope this helps.

If you issue is solved, please do not forget to close it.
Should you have further questions, kindly let me know.

Best,

Cedric

[ShrutiKetan]

Hi Cedric, Everything works well now. Just a trivial question. The metagenomic binning of a sample with a lot of fungi, the bins arent evident at all. Can yo please suggest a batter way to do this! Thank you so much. Regards, Shruti Kutmutia B3, SCELSE

…

________________________________________ From: Cedric Laczny [notifications@github.com] Sent: Thursday, April 25, 2019 7:19 PM To: claczny/VizBin Cc: Kutmutia Shruti Ketan; Mention Subject: Re: [claczny/VizBin] Annotation file (#42) Are all your contigs >= minimum length you specify in VizBin (default: >= 1,000 nt)? About this, not really! I have varied lengths. I am sorry i assumed than Vizbin would just ignore contigs below the set threshold. VizBin does ignore contigs below the threshold. However, when using an annotation file, the sequences are ignored, but not the respective annotations. This could be improved for sure in VizBin. Hence, your issue might be due to this. To overcome this, you might 1. filter the individual MaxBin bins according to length (e.g., >= 1,000 nt) 2. create per-bin annotation files, i.e., containing you categorical label (no header) as often as there are sequences in the filtered bin 3. concatenate the filtered bins -> contigs.size_selected.fa 4. concatenate the annotation files -> annotation.csv 5. put a "label" header into annotation.csv I have attached an image of what i see in the visualization window. I could unfortunately not see it attached. I assume this is because you replied via email and maybe GitHub's Issue system does not support this. Feel free to add the image to this issue (#42<#42>). Depending on the size of contig.fa you might also give BusyBee Web<https://ccb-microbe.cs.uni-saarland.de/busybee> a try. It complements some of the shortcomings of VizBin, it is web-based and thus has no user-level dependencies, but it provides less flexibility and has a maximum upload limit. Hope this helps. If you issue is solved, please do not forget to close it. Should you have further questions, kindly let me know. Best, Cedric — You are receiving this because you were mentioned. Reply to this email directly, view it on GitHub<#42 (comment)>, or mute the thread<https://github.com/notifications/unsubscribe-auth/AL5ILK3RAWKUQXPE6BJCN7TPSGHUBANCNFSM4HIKLGTQ>.

________________________________ CONFIDENTIALITY: This email is intended solely for the person(s) named and may be confidential and/or privileged. If you are not the intended recipient, please delete it, notify us and do not copy, use, or disclose its contents. Towards a sustainable earth: Print only when necessary. Thank you.

[claczny]

Hi @ShrutiKetan,

that's great to hear!

Could you please share briefly how you solved your issue?
I will also close the issue, but feel free to post related questions after that, if needed.

Regarding binning of fungal genomes, I have to admit that I have not much experience in this.
I know from experiences shared by others that fungal bins frequently separate rather clearly from bacterial bins, e.g., in the case of bacterial "symbionts" in/on fungi, but in these cases, the fungal organism was the host.

I assume that in your case, you have some microbiome derived from some "complex" host/environment (e.g., from an insect, mammal, or waste water)?
It also depends on the complexity/diversity of the microbiome.
Unfortunately (or maybe fortunately, depending on one's point-of-view), there exists currently no single-best binning solution, i.e., one should try multiple tools.
This is also why "binning consolidators", such as DAS tool (https://www.nature.com/articles/s41564-018-0171-1) have been developed.

Best,

Cedric