CapR4J

A java port of CapR, for calculating probabilities that each RNA base position is located within secondary structural contexts.

CapR4J is a port of the CapR algorithm orignially created by Fukunaga et al and implemented in C++. It requires no external depencies is hence platform independent. In addition, an API is available which allows for the integration of CapR into bioinformatics pipelines in a programmatic manner. This port also generates a graphical representation of the structural context probabilities for each input sequence.

Disclaimer: CapR is implemented and developed by Tsukasa Fukunaga et al. All intellectual credits of this work go to the original authors. My only contribution is the adaptation of the C source code to Java and the addition of the graphical representation.

Usage

java -jar capr4j INPUT_SEQUENCE
eg. java -jar GGGAGACAAGAATAAACGCTCAACAAACAACAGTACGTAGCATGCATGCTAGCTAGCTACTATGGGATTCGACAGGAGGCTCACAACAGGC

Precomiled Jar File

Please see the release section for the most recent version of CapR4J.

Compile From Source

CapR4J is a maven project:

git clone https://github.com/drivenbyentropy/capr4j.git
cd capr4j
mvn install

The compiled jar file can then be found in target\capr4j.jar

CapR4J API

If you want to integrate CapR4J in your own pipeline, you can use the provided API as such

public static void main(String[] args) {
	private static CapR capr = new CapR();
    
	// The sequence to be predicted
	String seq = new String("GGGAGACAAGAATAAACGCTCAACAAACAACAGTACGTAGCATGCATGCTAGCTAGCTACTATGGGATTCGACAGGAGGCTCACAACAGGC");
			
	// Compute profile
	capr.ComputeStructuralProfile(seq.getBytes(), seq.length());

	// Get profile. Returns a double array containing a linear representation of the context probabilities
	// in the form of [h1,h2,...,hn,i1,i2,...,in,b1,b2,...,bn,m1,m2,...,mn,d1,d2,...,dn] where h,i,b,m,d
	// stand for hairpin, inner loop, bulge loop, multiple loop, and dangling end respectively. The probability
	// of a positition being paired is can be computed as 1-(h+i+b+m+d).
	double[] profile =  capr.getStructuralProfile();
}