You signed in with another tab or window. Reload to refresh your session.You signed out in another tab or window. Reload to refresh your session.You switched accounts on another tab or window. Reload to refresh your session.Dismiss alert
>M18404.1 Human IgG2 lambda antibody (1B8.env reactive) gp41 coding region DNA
GCAGTGGGAAGAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCCTCAA
>M18404.1 Human IgG2 lambda antibody (1B8.env reactive) gp41 coding region DNA
GCAGTGGGAAGAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCCTCAA
Actual behavior
The '>' symbol is not recognized as indicating a new sequence
Expected behavior
The '>' symbol is recognized as indicating a new sequence. Each sequence should be imported as a separate molecule. The start of the sequence is the first symbol in a line after header line, the end of the sequence is the last symbol before ">" #1755
Desktop (please complete the following information):
OS: Windows 11
Browser Chrome
Version 112.0.5615.138 (Official Build) (64-bit)
Indigo version
[Version 1.19.0-rc.1]
Attachments
The text was updated successfully, but these errors were encountered:
Steps to Reproduce
Actual behavior
The '>' symbol is not recognized as indicating a new sequence
Expected behavior
The '>' symbol is recognized as indicating a new sequence. Each sequence should be imported as a separate molecule. The start of the sequence is the first symbol in a line after header line, the end of the sequence is the last symbol before ">"
#1755
Desktop (please complete the following information):
Indigo version
[Version 1.19.0-rc.1]
Attachments
The text was updated successfully, but these errors were encountered: