-
Notifications
You must be signed in to change notification settings - Fork 0
gui11aume/oligoz
Folders and files
Name | Name | Last commit message | Last commit date | |
---|---|---|---|---|
Repository files navigation
Time is important, but PCR is everything. -- Leonardo Da Vinci If you end up reading this file, you are either desperately looking for large-scale open source PCR primer design software, or you are a member of my team. Either way, this is the right place to start. Oligoz is a single file Python module. You can import it, or run it as a command line app. To use Oligoz as a command line, start by putting the target sequences for which you want to design primers in a single fasta file, say 'seq.fasta'. Then run the following from the command line: python oligoz.py seq.fasta The Oligoz module defines a bunch of classes that may be useful for other applications in molecular biology. You will have to look at the source code for a comprehensive overview. The most important features are the classes 'DNAseq', 'RNAseq', 'Oligo' and 'OligoSol'. Note that the Tm is not a property of the oligo sequence because it depends on the concentration of the oligo (and of the target sequence), so only 'OligoSol' has a 'Tm' attribute. Here is how you can import the module in an interactive Python session and use it to compute a Tm. import oligoz oligoz.OligoSol('GATCGATCGATCGATCGTAC').Tm Note that the Tm is computed for a default 1 uM solution in the Phusion PCR buffer. Oh yes, and don't freak out if the Tm shown above is higher than 330 degrees, it is because the temperature is in Kelvin. So just in case you would forget the value of the absolute zero, I put it there as 'ABS0'. oligoz.OligoSol('GATCGATCGATCGATCGTAC').Tm + oligoz.ABS0
About
oligoz primer design
Resources
Stars
Watchers
Forks
Releases
No releases published
Packages 0
No packages published