Time is important, but PCR is everything.
                   -- Leonardo Da Vinci

If you end up reading this file, you are either desperately looking for
large-scale open source PCR primer design software, or you are a member
of my team.

Either way, this is the right place to start. Oligoz is a single file
Python module. You can import it, or run it as a command line app.

To use Oligoz as a command line, start by putting the target sequences for
which you want to design primers in a single fasta file, say 'seq.fasta'.
Then run the following from the command line:

python oligoz.py seq.fasta

The Oligoz module defines a bunch of classes that may be useful for other
applications in molecular biology. You will have to look at the source
code for a comprehensive overview. The most important features are the
classes 'DNAseq', 'RNAseq', 'Oligo' and 'OligoSol'. Note that the Tm is
not a property of the oligo sequence because it depends on the concentration
of the oligo (and of the target sequence), so only 'OligoSol' has a 'Tm'
attribute.

Here is how you can import the module in an interactive Python session and
use it to compute a Tm.

import oligoz
oligoz.OligoSol('GATCGATCGATCGATCGTAC').Tm

Note that the Tm is computed for a default 1 uM solution in the Phusion PCR
buffer. Oh yes, and don't freak out if the Tm shown above is higher than
330 degrees, it is because the temperature is in Kelvin. So just in case
you would forget the value of the absolute zero, I put it there as 'ABS0'.

oligoz.OligoSol('GATCGATCGATCGATCGTAC').Tm + oligoz.ABS0