primer3-py is a collection of Python bindings for a derivative of the
popular Primer3 version 2.3.6 C library. The package provides a simple API
for low-level thermodynamic calculations pertinent to oligonucleotide design
(e.g., melting temperature) as well as a simple interface to the Primer3 design
engine for a more holistic approach to primer design. All of the bindings
are implemented using the Python C API, which means that they are
highly efficient but do require initial compilation (see Installation,
below).
We do not provide any additional abstraction of the Primer3 design engine, so we suggest that you refer to the official Primer3 documentation for assistance.
primer3-py has no external library dependencies and should compile on
most linux and OS X systems that are running Python 2.7, 3.3, or 3.4.
To build primer3-py within the package directory run:
$ python setup.py build_ext --inplace
If you would like to install primer3-py in your local Python environment you may do so using either pip or the setup.py script:
$ pip install primer3-py
or
$ python setup.py install
We have included a comprehensive test suite to compare the output of
the Python bindings with the output of the Primer3 binaries. After
building and (optionally) installing primer3-py you can run the
tests using the primer3_tests.py module:
$ python primer3_tests.py
or for memory checking with valgrind:
$ valgrind --tool=memcheck --suppressions=valgrind-python.supp --leak-check=full python primer3_test.py
primer3-py includes a unified API for low-level thermodynamic
calculations that are useful for routine oligonucleotide design.
The simplest API function is calcTm, which uses nearest-neighbor
thermodynamics to calculate the melting temperature of a provided DNA
sequence:
>>> import primer3
>>> primer3.calcTm('ATTTGGGACCAATTTGGACCAGGTT')
57.02235387653167
Higher-level thermodynamic functions include calcHairpin,
calcHomodimer, and calcHeterodimer. These functions perform a
thermodynamic alignment to determine the characteristics (dH, dS, dG, Tm)
of a secondary / multi-stranded structure. All three functions return
a namedtuple:
>>> from primer3 import calcHeterodimer
>>> res = calcHeterodimer('CCGACCCTATGGGACC', 'TTGGTCCCATAAGGGTCGG')
>>> print(res)
thermoresult(
structure_found=True,
tm=39.92795428766294,
ds=-370.12644214999796,
dh=-127200.0,
dg=-12405.28396717814,
align_end_1=16,
align_end_2=17
)
>>> print res.tm
39.92795428766294
For more detailed documentation and usage examples, see
primer3/bindings.py and primer3_test.py.
primer3-py also includes C API bindings for the Primer3 design engine.
As mentioned above, we do not provide any additional "Pythonic" abstraction
of the original design process (that's up to you!) so the general
interface is basically Boulder IO input/output in the form of Python
dictionaries.
There are few deviations from the formats described in the Primer3
documentation, with notable exceptions being related to index lists and
ranges (i.e., ranges are typically provided as lists/tuples, and lists
of ranges as lists of lists or tuples of tuples). Here we highlight the
differences between the typical SEQUENCE_PRIMER_PAIR_OK_REGION_LIST
input and the Python binding input:
Primer3 boulder IO input: 100,50,300,50 ; 900,60,, Primer3 python input: [[100,50,300,50], [900,60,-1,-1]]
Similarly, PRIMER_PRODUCT_SIZE_RANGE is provided in the following forms:
Primer3 boulder IO input: 75-100 100-125 125-150 Primer3 python input: [[75,100],[100,125],[125,150]]
For more detailed documentation and usage examples, see
primer3/bindings.py and primer3_test.py.
We are very grateful for any bug fixes or suggestions that you may have. If you would like to report an issue or idea, or if you would like to contribute to the project, please visit the project's Github page (http://github.com/benpruitt/primer3-py)
Citations should reference the lastest Primer3 paper:
Untergasser, Andreas, et al. "Primer3—new capabilities and interfaces." Nucleic acids research 40.15 (2012): e115-e115. doi: 10.1093/nar/gks596
All project code, including the derivative Primer3 library, is licensed under GPLv2. The included Python and Python C API bindings are Copyright (c) 2014 Ben Pruitt, Nick Conway; Wyss Institute for Biologically Inspired Engineering.