Use Makefile to generate an executable file "mTR".
usage: mTR [-acp] [-m ratio]
-a: Output the alignment between the input sequence and predicted tandem repeat.
-c: Print the computation time of each step.
-m ratio: Give a minimum match ratio ranging from 0 to 1.
-p: Use Pearson's correlation coefficient distance in place of Manhattan distance.
/*----------------------------------------- Features associated with one read with repeats
read identifier
read length
repeat start position (1-origin index)
repeat end position (1-origin index)
repeat length
unit length
number of unit occurrences
Matches Number of matches between the actual repeat and the tandem repeat
Match ratio Ratio of the number of matches to the length of actual repeat determined
Mismacthes Number of mismatches
Insertions Number of insertions
Deletions Number of deletions
unit string
Example
read identifier = 10_20_0_5_5_100_100_10.fasta_0,
read length = 1200,
repeat start position = 28,
repeat end position = 1090,
repeat length = 1063,
unit length = 101,
number of unit occurrences = 10,
Matches = 852,
Match ratio = 0.8015,
Mismacthes = 137,
Insertions = 101,
Deletions = 74,
unit string = GTGACCCCGCGGTAGCATAGCGGCTGAATGCCAGATACACATGTCAAGTCGTGGTGGCCCCGGTACTGGCTTCCGAGGCTGTAGAAAACCTATTCCCAGCG,