poly-A before poly-G in NextSeq reads

[PAMorin]

Hi,
I am seeing a large portion of NextSeq reads that have the poly-G tail, and have successfully trimmed that off with fastp. Most sequences also have a poly-A run just before the poly-G tail, which is apparently due to reduction in signal strength (lower quality) from clusters before they fail altogether (see https://sequencing.qcfail.com/articles/illumina-2-colour-chemistry-can-overcall-high-confidence-g-bases/). I tried to use the -x function in the same trimming command, but it doesn't work (presumably because it isn't at the end of the original read). I suppose I could try it as a second trimming process, but wanted to know if this is a common issue that people with poly-G reads from NextSeq data see, and if so, could it be incorporated into the options.
The data look like this after trimming:
@NS500704:337:HGG2HBGX3:1:11101:10170:2997 1:N:0:GACGAGG+CGGAAT
GCAAGGTCTTAATCAAATTTTGTCAGCTGCAAGATCGAAGAGCACACGTCTGAACTCCAGTCACGACGAGGATCTCGTATGCCGTCTTCTGCGTGAAAAAAAAAA
+
AAAAAEEEEEAEEEE6EEAEEEEEEEEEEEEEEEEEEE/EEEEEEEEAEEEEE/EEEEEEEEEEEAEE/EEEA</AE/AEE<E</6<E//EE/EE/<AAEEEEA/
@NS500704:337:HGG2HBGX3:1:11101:8528:3344 1:N:0:GACGAGG+CGGAAT
ACAGAAACAGGTGCACAGTTCCCCATCAAGATCGGAAGACACACGTCTGAACTCCAGTCACGACGAGGCTCTCGTATGCCGTCTTCTGCATGAAAAAAAAAA
+
AAAAAAEEEEEE6E/AEEE/EEEEEEEEEE/EEEEEEEEE/EAEEEEEE/AE/EAE/AEEEEEEA/EE/AE<///A<E<E//<EE//////A/EEEEEE///

Thanks,
Phil Morin (phillip.morin@noaa.gov)

[sfchen]

Thanks Phil.

In current design if polyG and polyX are both enabled, polyG will be ignored since I thought it's part of polyX.

Please wait for 10 minutes, I will make an update to support polyG trimming --> polyX trimming when they are both enabled.

Thanks
Shifu

[sfchen]

Hi @PAMorin

I just pushed the update.

Please try to build fastp with latest code on master. Or download http://opengene.org/fastp/fastp to test again.

Thanks
Shifu

[PAMorin]

Hi Shifu, I asked our Linux system administrator to re-install fastp and forwarded him your message. He tried this morning, and had problems. He wrote: When I try to build fastp from the source code I am getting the following error..... [root@ahi fastp]# make g++ -std=c++11 -g -I./inc -O3 -c  src/adaptertrimmer.cpp -o obj/adaptertrimmer.o cc1plus: error: unrecognized command line option "-std=c++11" make: *** [obj/adaptertrimmer.o] Error 1 When I installed it the first time I downloaded the pre-compiled binaries for CentOS/Unbuntu.  Has that distribution been updated - can we install from that distribution? Please let me know if we can install from the pre-compiled binaries, or if there is another way to install. Thanks, Phil

…

On 3/8/18 4:53 PM, Shifu Chen wrote: Hi @PAMorin <https://github.com/pamorin> I just pushed the update. Please try to build fastp with latest code on master. Or download http://opengene.org/fastp/fastp to test again. Thanks Shifu — You are receiving this because you were mentioned. Reply to this email directly, view it on GitHub <#36 (comment)>, or mute the thread <https://github.com/notifications/unsubscribe-auth/AUACRZ5mR2FzkxKoUZP4vveFbGVPH-2rks5tcdJ5gaJpZM4SjkHf>.

-- -- Phillip A. Morin, Ph.D. Southwest Fisheries Science Center 8901 La Jolla Shores Dr. La Jolla, CA 92037, USA Phone: 858-546-7165 Fax: 858-546-7003 phillip.morin@noaa.gov http://swfsc.noaa.gov/mmtd-mmgenetics

[sfchen]

Hi Phil,

Your system's gcc compiler is too old (before 2011), so that it doesn't support C++ 11. You can either:

1. use the new pre-compiled binary of fastp, which can be downloaded from http://opengene.org/fastp/fastp
2. or ask your system administrator to update the gcc compiler.

[mblue9]

Hi @sfchen I think I may have this issue too and would love to try this option, will there be a new Bioconda version of fastp with this?

[sfchen]

Hi @mblue9

A new version of fastp will be released once these new features are well tested. Bioconda version will also be updated soon (usually with one day delay).

[mblue9]

Great, thanks!

[sfchen]

Implemented and fixed.

@mblue9 new version is already in Bioconda.

I am closing this issue.