xTea Long_read SyntaxWarning

[vaksmaz]

I am running long read (nanopore) crams with the following commands:

BAMS=long_read_bam_list.txt
WFOLDER=/gpfs/commons/groups/compbio/vaksman/Long_read/test_COLO829-T/COLO829-T/
OUT_SCRTP=submit_jobs.sh
TIME=60:00
REF=/path to/GRCh38_full_analysis_set_plus_decoy_hla.fa
XTEA=/path to/xTea/xtea_long/
RMSK=/path to/xTea/rep_lib_annotation/LINE/hg38/hg38_L1_larger500_with_all_L1HS.out
CNS_L1=/path to/xTea/rep_lib_annotation/consensus/LINE1.fa
REP_LIB=/path to/xTea/rep_lib_annotation/
 
 python ${XTEA}"gnrt_pipeline_local_long_read_v38.py"  \
 -i ${SAMPLE_ID} -b ${BAMS} -p ${WFOLDER} -o ${OUT_SCRTP} \
 --xtea ${XTEA} \
 -n 16 -m 48 -t ${TIME} \
 -r ${REF} --rmsk ${RMSK} \
 --cns ${CNS_L1} --rep ${REP_LIB}  \
 --min 4000  -f 31 -y 15 --clean --fast \
--mei_no_asm --complex --slurm```

and I get the following massage:
Further the code does not run through just goes to sleep after 26 hours of running. No errors , Just sleeps

```/gpfs/commons/groups/compbio/vaksman/bin/xTea_long/xTea/xtea_long/x_reference.py:26: SyntaxWarning: "is" with a literal. Did you mean "=="?
  if len(chrm)>3 and ((chrm[:3] is "HLA") or (chrm[:3] is "HPV") or (chrm[:3] is "HIV") or (chrm[:3] is "CMV")
/gpfs/commons/groups/compbio/vaksman/bin/xTea_long/xTea/xtea_long/x_reference.py:26: SyntaxWarning: "is" with a literal. Did you mean "=="?
  if len(chrm)>3 and ((chrm[:3] is "HLA") or (chrm[:3] is "HPV") or (chrm[:3] is "HIV") or (chrm[:3] is "CMV")
/gpfs/commons/groups/compbio/vaksman/bin/xTea_long/xTea/xtea_long/x_reference.py:26: SyntaxWarning: "is" with a literal. Did you mean "=="?
  if len(chrm)>3 and ((chrm[:3] is "HLA") or (chrm[:3] is "HPV") or (chrm[:3] is "HIV") or (chrm[:3] is "CMV")
/gpfs/commons/groups/compbio/vaksman/bin/xTea_long/xTea/xtea_long/x_reference.py:26: SyntaxWarning: "is" with a literal. Did you mean "=="?
  if len(chrm)>3 and ((chrm[:3] is "HLA") or (chrm[:3] is "HPV") or (chrm[:3] is "HIV") or (chrm[:3] is "CMV")
/gpfs/commons/groups/compbio/vaksman/bin/xTea_long/xTea/xtea_long/x_reference.py:27: SyntaxWarning: "is" with a literal. Did you mean "=="?
  or (chrm[:3] is "CMV") or (chrm[:3] is "MCV") or (chrm[:2] is "SV") or (chrm[:4] is "KSHV")
/gpfs/commons/groups/compbio/vaksman/bin/xTea_long/xTea/xtea_long/x_reference.py:27: SyntaxWarning: "is" with a literal. Did you mean "=="?
  or (chrm[:3] is "CMV") or (chrm[:3] is "MCV") or (chrm[:2] is "SV") or (chrm[:4] is "KSHV")
/gpfs/commons/groups/compbio/vaksman/bin/xTea_long/xTea/xtea_long/x_reference.py:27: SyntaxWarning: "is" with a literal. Did you mean "=="?
  or (chrm[:3] is "CMV") or (chrm[:3] is "MCV") or (chrm[:2] is "SV") or (chrm[:4] is "KSHV")
/gpfs/commons/groups/compbio/vaksman/bin/xTea_long/xTea/xtea_long/x_reference.py:27: SyntaxWarning: "is" with a literal. Did you mean "=="?
  or (chrm[:3] is "CMV") or (chrm[:3] is "MCV") or (chrm[:2] is "SV") or (chrm[:4] is "KSHV")
/gpfs/commons/groups/compbio/vaksman/bin/xTea_long/xTea/xtea_long/x_reference.py:28: SyntaxWarning: "is" with a literal. Did you mean "=="?
  or (chrm[:5] is "decoy") or (chrm[:6] is "random")):#this is some special fields in the bam file
/gpfs/commons/groups/compbio/vaksman/bin/xTea_long/xTea/xtea_long/x_reference.py:28: SyntaxWarning: "is" with a literal. Did you mean "=="?
  or (chrm[:5] is "decoy") or (chrm[:6] is "random")):#this is some special fields in the bam file
/gpfs/commons/groups/compbio/vaksman/bin/xTea_long/xTea/xtea_long/l_rep_masker.py:489: SyntaxWarning: "is" with a literal. Did you mean "=="?
  if (s_polyA is self._s_no_polyA) and (s_TSD is "None"):
/gpfs/commons/groups/compbio/vaksman/bin/xTea_long/xTea/xtea_long/l_rep_masker.py:796: SyntaxWarning: "is" with a literal. Did you mean "=="?
  if s_rg is "":
/gpfs/commons/groups/compbio/vaksman/bin/xTea_long/xTea/xtea_long/l_output_fmt_parser.py:35: SyntaxWarning: "is" with a literal. Did you mean "=="?
  return s_chk is "None"
/gpfs/commons/groups/compbio/vaksman/bin/xTea_long/xTea/xtea_long/l_transduction.py:575: SyntaxWarning: "is not" with a literal. Did you mean "!="?
  if s_region1 is not "None":
/gpfs/commons/groups/compbio/vaksman/bin/xTea_long/xTea/xtea_long/l_transduction.py:577: SyntaxWarning: "is not" with a literal. Did you mean "!="?
  if s_region2 is not "None":```

[simoncchu]

I am not sure what's the depth of the file. If it is a sample of high depth, I would suggest trying with a larger memory.

[vaksmaz]

An increase in memory worked. It is using lots of ram, is that OK. Also, can you give a bit of information on the Long_Read output (example, what does this mean chr41584154715847572L1HS0R511~116 (see below) ). Most things are self evident but some are a bit hard to interpret. Which column is for gene annotation. etc...

Also, does long-read support somatic analysis?

6	66703922	LINE1	internal_inversion	4242:5324:+	5328:6070:-	CTATATCTTCTGGTAGAAACCTCAAGGCAAAATCAATTAGATTTCCAACT	chr4~15841547~15847572~L1HS~0R~51~1~116	None	TTTTTGGGGTAAGACCAATTTTTTATTTTCCCCGTCTTTGTCTAGGTTTCTACTATTCTATTTTCTCCATGGAACATATCTTTGAACAGCTTAGACTGGTCAGATATCTGCAAGATTGCTTTTTTTTTTTTTTTTTTCTTTGAGAGTTGTTTTTTATTTATTTTTTTTTTTTTTATACTCTAAGTTTTAGGGTACATGTGCACATTGTGCAGGTTAGTTACATATGTATACATGTGCCATGCTGGTGCGCTGCACCCACTAATGTGTCATCTAGCATTAGGTATATCTCCCAATGCTATCCCTCCCCCCCCCCCCCCACCACAGTCCCCAGAGTGTGATATTCCCCTTCCTGTGTCCATGTGATCTCATTGTTCAATTCCCACCTATGAGTGAGAATATGCGGTGTTTGGTTTTTTGTTCTTGCGATAGTTTACTGAGAATGATGGTTTCCAATTTCATCCATGTCCCTACAAAGGATATGAACTCATCATTTTTTATGGCTGCATAGTATTCCATGGTGTATATGTGCCACATTTTCTTAATCCAGTCATCATTGTTGGACATTTGGGTTGGTTCCAAGCTTTGCTATTGTGAATAGTGCCGCAATAAACATACGTGTGCAGTGTCTTTATAGAAATGTTTATATCATTTGGGAAAAATTTCCCCAAAAGGGATGGCTGGGGCAAAAAGGGAAATTTTTAATTTAATCCCCGAGGAATCGCCACACTGACTTCCACAATGGTTGGAAATAGTTTACAGTCCCACCAACAGTGTAAAAGTGTTCCCCATTTCTCCACATCCTCTCCAGCACCTGTTGTTTCCTGACTTTTTAATGATTGCCATTCTAACTGGTGTGAGAACAAATTATGGGGGAACTCCCATTCACAATTGCTTCAAAGAGAATAAAATACCTAGGAATCCAACTTACAAGGGATGTGAAGGACCTCTTCAAGGAGAACTACAAACCACTGCTCAAGGAAATAAAAGAGGACACAAACAAATGGAAGAACATTCCATGCTCATGGGTAGGAAGAATCAATATCGTGAAAATGGCCATACTGCCCAAGGTAATTTACAGATTCAATGCCATCCCCATCAAGCTACCAATGACTTTCTTCACAGAATTGGAAAAAACTACTTTAAAGTTCATATGGAACCAAAAAAGAGCCCGCATTGCCAAGTCAATCCTAAGCCAAAAGAACAAAGCTGGAGGCATCACACTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTACCAAAACAGAGATATAGACCCAAAGGAACAGAACAGAGCCCTCAGAAATAATGCCGCATATCTACAACTATCTGATCTTTACAAACCTGGAAAAAAAAAGCAATGGGGAAAGGATTCCCTATTTAATAAATGGTGCTGGGAAAACTGGCTAGCCATATGTAGAAAGCTGAAACTGGATCCCTTCCTTACACCTTATACAAAAATCAATTCAAGATGGATTAAAGATTTAAACGTTAAACCTAAAACCATAAAAACCCTAGAAGAAAACCTAGGCATTACCATTCAGGACATAGGCGTGGGCAAGGACTTCATGTCCAAAACACCAAAAGCAATGGCAACAAAAGACAAAATTGACAAATGGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAGAAACTACCATCAGAGTGAACAGGCAACCTACAACATGGGAGAAAATTTTTGCAACCTACTCATCTGACAAAGGGCTAATATCCAGAATCTACAATGAACTCAAACAAATTTACAAGAAAAAAACAAACAACCCCATCAAAAAGTGGGCGAAGGTCATGAACAGACACTTCTCAAAAGAAGACATTTATGCAGCCAAAAAACACATGAAGAAATGCTCATCATCACTGGCCATCAGAGAAATGCAAATCAAAACCACTATGAGATACTATATCTTCTGGTAGAAACCTCAAGGCAAAATCAATTAGATTTCCAACT	GCAATCTTGCAGATATCTGACCAGTCTAAGCTGTTCAAAGATATGTTCCATGGAGAAAATAGAATAGTAGAAACCTAGACAAAGACGGGGAAAATAAAAAATTGGTCTTACCCCAA	None	clip_seq_with_polyA```

[simoncchu]

I have some notes here: https://github.com/parklab/xTea_paper/tree/main/run_tools/xTea/HG002 for the columns.

Long-read module doesn't have a somatic mode, which means it outputs combined germline and potential somatic. Also, it used a local assembly step, thus will miss the low VAF ones if the assembly step failed because of the low depth.

[vaksmaz]

And how do I interpret this chr4~15841547~15847572~L1HS~0R~51~1~116 in the example above?

[simoncchu]

It indicates this insertion contains a transduction region from a reference L1HS copy chr4:15841547-15847572, and the length of the transduction sequence is 116bp.

[vaksmaz]

Thank you very much for all the help.