Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Jump to bottom

Error in jellyfish #848

Closed
Wenwen012345 opened this issue May 26, 2020 · 17 comments
Closed

Error in jellyfish #848

Wenwen012345 opened this issue May 26, 2020 · 17 comments

Comments

@Wenwen012345
Copy link

Wenwen012345 commented May 26, 2020 •
edited

Hello, everyone!
Hello, Brain!
I got a error report (for jellyfish) in my Trinity 2.9.1 software running procedure. I think the mistake might be from my sequence (probally from the head name), but I tried many methods it still can't run for a whole procedure. I have no idea about the actual problem happening. So I have to be here to ask researchers here and Mr.Brain. Thank you very much!
The following is the report and the head of my sequence.

Running Statistics:

Trinity Version: Trinity-v2.9.1
Compiler: GCC
Trinity Parameters: --seqType fa --max_memory 200G --left /home/manager/share1/fastq_normal/SRR850813_1.fastq --right /home/manager/share1/fastq_normal/SRR850813_2.fastq --CPU 6 --output /home/manager/share1/trinity_AP6_test

Report:
Trinity-v2.9.1

Left read files: $VAR1 = [
'/home/manager/share1/fastq_normal/SRR850813_1.fastq'
];
Right read files: $VAR1 = [
'/home/manager/share1/fastq_normal/SRR850813_2.fastq'
];
Trinity version: Trinity-v2.9.1
** NOTE: Latest version of Trinity is v2.10.0, and can be obtained at:
https://github.com/trinityrnaseq/trinityrnaseq/releases

Tuesday, May 26, 2020: 08:48:27 CMD: java -Xmx64m -XX:ParallelGCThreads=2 -jar /home/manager/miniconda3/opt/trinity-2.9.1/util/support_scripts/ExitTester.jar 0
Tuesday, May 26, 2020: 08:48:27 CMD: java -Xmx4g -XX:ParallelGCThreads=2 -jar /home/manager/miniconda3/opt/trinity-2.9.1/util/support_scripts/ExitTester.jar 1
Tuesday, May 26, 2020: 08:48:27 CMD: mkdir -p /home/manager/share1/trinity_AP6_test
Tuesday, May 26, 2020: 08:48:27 CMD: mkdir -p /home/manager/share1/trinity_AP6_test/chrysalis

-------------- Trinity Phase 1: Clustering of RNA-Seq Reads ---------------------

------------ In silico Read Normalization ---------------------
-- (Removing Excess Reads Beyond 200 Coverage --

running normalization on reads: $VAR1 = [

      [
        '/home/manager/share1/fastq_normal/SRR850813_1.fastq'
      ],
      [
        '/home/manager/share1/fastq_normal/SRR850813_2.fastq'
      ]
    ];

Tuesday, May 26, 2020: 08:48:27 CMD: /home/manager/miniconda3/opt/trinity-2.9.1/util/insilico_read_normalization.pl --seqType fa --JM 200G --max_cov 200 --min_cov 1 --CPU 6 --output /home/manager/share1/trinity_AP6_test/insilico_read_normalization --max_CV 10000 --left /home/manager/share1/fastq_normal/SRR850813_1.fastq --right /home/manager/share1/fastq_normal/SRR850813_2.fastq --pairs_together --PARALLEL_STATS
-prepping seqs
Converting input files. (both directions in parallel)CMD: cat /home/manager/share1/fastq_normal/SRR850813_1.fastq >> left.fa
CMD: cat /home/manager/share1/fastq_normal/SRR850813_2.fastq >> right.fa
CMD finished (445 seconds)
CMD finished (446 seconds)
CMD: touch left.fa.ok
CMD finished (0 seconds)
CMD: touch right.fa.ok
CMD finished (0 seconds)
Done converting input files.CMD: cat left.fa right.fa > both.fa
CMD finished (274 seconds)
CMD: touch both.fa.ok
CMD finished (0 seconds)
-kmer counting.

----------- Jellyfish --------------------
-- (building a k-mer catalog from reads) --

CMD: jellyfish count -t 6 -m 25 -s 28921204837 --canonical both.fa
terminate called after throwing an instance of 'jellyfish::large_hash::array_base<jellyfish::mer_dna_ns::mer_base_static<unsigned long, 0>, unsigned long, atomic::gcc, jellyfish::large_hash::unbounded_array<jellyfish::mer_dna_ns::mer_base_static<unsigned long, 0>, unsigned long, atomic::gcc, allocators::mmap> >::ErrorAllocation'
what(): Failed to allocate 111400196440 bytes of memory
Error, cmd: jellyfish count -t 6 -m 25 -s 28921204837 --canonical both.fa died with ret 6 at /home/manager/miniconda3/opt/trinity-2.9.1/util/insilico_read_normalization.pl line 793.
Error, cmd: /home/manager/miniconda3/opt/trinity-2.9.1/util/insilico_read_normalization.pl --seqType fa --JM 200G --max_cov 200 --min_cov 1 --CPU 6 --output /home/manager/share1/trinity_AP6_test/insilico_read_normalization --max_CV 10000 --left /home/manager/share1/fastq_normal/SRR850813_1.fastq --right /home/manager/share1/fastq_normal/SRR850813_2.fastq --pairs_together --PARALLEL_STATS died with ret 512 at /home/manager/miniconda3/bin/Trinity line 2798.
main::process_cmd("/home/manager/miniconda3/opt/trinity-2.9.1/util/insilico_read"...) called at /home/manager/miniconda3/bin/Trinity line 3348
main::normalize("/home/manager/share1/trinity_AP6_test/insilico_read_normaliza"..., 200, ARRAY(0x7f4c529ae260), ARRAY(0x7f4c529ae290)) called at /home/manager/miniconda3/bin/Trinity line 3291
main::run_normalization(200, ARRAY(0x7f4c529ae260), ARRAY(0x7f4c529ae290)) called at /home/manager/miniconda3/bin/Trinity line 1351

----------------Head of my sequence:-------------------------
@1/1
TCCCNAATGACCGAAGAAAAGAAAGAAGGCAACTCAATGGCGATTTCTATGCTGAGGAGATTGTGCACCGACACCAGAGAAAAGTAGCAG
+SRR850813.1 1 length=90
CCCF#2ADHHHHHJJJJIJJJJJJIJJJJGIGJJJJJJJJFIHIJJJJHIJJJJJHHHHFFFFFEEEEEDDDDDDDDDDDCDDDDDDDDD
@2/1
AAGANAAAAAAGACACTAATGGTAACTCTTCGAGCTGACGAAATTAGTAATATTATCCGTGAACGTATTGAACAATATAATAGAGAAGTA
+SRR850813.2 2 length=90
CCCF#2ADHHHHHJJJJJJJIJIJJJJGHIJJGIJJIIIIIIJIJGIHIJJIJJIJGHIJHGHHFFFFFCCEEEEACCDEDDDCDDDDDD
@3/1
ATCGNGAAGGCTCAGGCCGCGTTCCTCGCGAGGTGCAAGGCGAACTCAGAGGCAACCCTTGGGACTTACAAGGGAGATGCTGCCCAGGTT
manager@bl8vbox[fastq_normal] head -50 SRR850813_1.fastq [ 9:10AM]
@1/1
TCCCNAATGACCGAAGAAAAGAAAGAAGGCAACTCAATGGCGATTTCTATGCTGAGGAGATTGTGCACCGACACCAGAGAAAAGTAGCAG
+SRR850813.1 1 length=90
CCCF#2ADHHHHHJJJJIJJJJJJIJJJJGIGJJJJJJJJFIHIJJJJHIJJJJJHHHHFFFFFEEEEEDDDDDDDDDDDCDDDDDDDDD
@2/1
AAGANAAAAAAGACACTAATGGTAACTCTTCGAGCTGACGAAATTAGTAATATTATCCGTGAACGTATTGAACAATATAATAGAGAAGTA
+SRR850813.2 2 length=90
CCCF#2ADHHHHHJJJJJJJIJIJJJJGHIJJGIJJIIIIIIJIJGIHIJJIJJIJGHIJHGHHFFFFFCCEEEEACCDEDDDCDDDDDD
@3/1
ATCGNGAAGGCTCAGGCCGCGTTCCTCGCGAGGTGCAAGGCGAACTCAGAGGCAACCCTTGGGACTTACAAGGGAGATGCTGCCCAGGTT
+SRR850813.3 3 length=90
CC@F#2ADHHHGHJJJIJJIIGJJJIHIIJAGG;DHIGGHEFCDDDDDDCCDBDDBDDDDDDD?BADDCDDDD?A@9CDDDDDDDDDDCC
@4/1
AACANAAAGTGCTTCTAAGCATGATGCATCGTGCATTTCAGCTGTCTTGTTAGGAAAAGGGGAAAAGAAGAGAACGAGGGATACAGTTTC
+SRR850813.4 4 length=90
???D#2=ACAAAFGHIFIICBHCHICGHIGEFHIIIIIIIFDGHIGGIIIEDFB>BFBFHII>HGIIGFDAEDD@B<>B?@ccccc@CDC
@5/1
CTCCCATACTTATCCTACATTTACTGATGAGATTTACCAATTAAAAAAACCTGGACCTGCCCTTGAAATCAATTCTTTTCCAGCATCTTT
+SRR850813.5 5 length=90
CCBFFFFFHHHGHJJIJJJJJJIJJIJJJIIHHHJGIIJJIJIIJGIGJEHIJJIIJJJJJIIJHEHHGGFFFF??CEEACEEDCDDDDD
@6/1
CTCCAAGTTCCCAATACGCGTAATAACTTGTATTGATTCTTTTATAGATATCGTATCTTGCCCCTCTCTTTTTGATTTTGTGAGGTTTTC
+SRR850813.6 6 length=90
BCCFFFFFHHHHGIJFIJJJIJGIIIIIJGHGIIIHIJDGIIJEHGIGIJJIJJJHGIJIJJIJJHHHHHHFF??@Ceeee?CCD>ADBC
@7/1
CTGGNGACCATTCATTTCCCACCTGATTATCCATTTAAGCCACCCAAGGTCTCCTTCCGAACCAAAGTTTTTCACCCAAATATCAATAGT
+SRR850813.7 7 length=90
@@@d#2=BADFDHIGGEBIGIDEFB3CFEDH@GHIGCD@FGE@DFD@GGGGE?BDFEGEAFH@AAACCDFDCA@A;
@8/1
CTTCNGGGTATCATGGAACGTGTTTGTGCGCTTTCTTCTGATGTAGTGCATCAGGTGGTTGAGTTGGCTCTTCAGCTTCTTGAGTGCCCT
+SRR850813.8 8 length=90
@ccf#2ADCFHHHGGIIJJGFEBGIIIGIIJIJJGIJGGGEGIEHGIGEHIHGHIHIJJJGGIIJHHFHGFFFFFEFEEEE;>ACDCDDD

Note: This is not my own sequence in the initial sequencing procedure. Therefore, some details could be ignored by me, if noticed you can tell me :-). Thank you!

Best Regards!

Sulin
@brianjohnhaas
Copy link
Member

brianjohnhaas commented May 26, 2020 via email

@Wenwen012345
Copy link
Author

Hello! @brianjohnhaas Mr.Brain!
Thanks for your reply!
I have tried the "max_memory 50G" parameter, but it still showed the same error as before.

@brianjohnhaas
Copy link
Member

brianjohnhaas commented May 27, 2020 via email

@Wenwen012345
Copy link
Author

Wenwen012345 commented May 28, 2020 •
edited

@brianjohnhaas OK! Thanks very much！
Yes, it seems allocate different amounts of RAM.
This is the current error message with "max_memmory 50G". Please check!

----------- Jellyfish --------------------
-- (building a k-mer catalog from reads) --

CMD: jellyfish count -t 6 -m 25 -s 6891790604 --canonical both.fa
terminate called after throwing an instance of 'jellyfish::large_hash::array_base<jellyfish::mer_dna_ns::mer_base_static<unsigned long, 0>, unsigned long, atomic::gcc, jellyfish::large_hash::unbounded_array<jellyfish::mer_dna_ns::mer_base_static<unsigned long, 0>, unsigned long, atomic::gcc, allocators::mmap> >::ErrorAllocation'
what(): Failed to allocate 27567162416 bytes of memory
Error, cmd: jellyfish count -t 6 -m 25 -s 6891790604 --canonical both.fa died with ret 6 at /home/manager/miniconda3/opt/trinity-2.9.1/util/insilico_read_normalization.pl line 793.
Error, cmd: /home/manager/miniconda3/opt/trinity-2.9.1/util/insilico_read_normalization.pl --seqType fq --JM 50G --max_cov 200 --min_cov 1 --CPU 6 --output /home/manager/share1/trinity_AP7_test/insilico_read_normalization --max_CV 10000 --left /home/manager/share1/fastq_normal/SRR850813_1.fastq --right /home/manager/share1/fastq_normal/SRR850813_2.fastq --pairs_together --PARALLEL_STATS died with ret 512 at /home/manager/miniconda3/bin/Trinity line 2798.
main::process_cmd("/home/manager/miniconda3/opt/trinity-2.9.1/util/insilico_read"...) called at /home/manager/miniconda3/bin/Trinity line 3348
main::normalize("/home/manager/share1/trinity_AP7_test/insilico_read_normaliza"..., 200, ARRAY(0x7f4389d96160), ARRAY(0x7f4389d96190)) called at /home/manager/miniconda3/bin/Trinity line 3291
main::run_normalization(200, ARRAY(0x7f4389d96160), ARRAY(0x7f4389d96190)) called at /home/manager/miniconda3/bin/Trinity line 1351
manager@bl8vbox[share1] Trinity --seqType fq --max_memory 500G --left /home/manager/share1/fastq_normal/SRR850813_1.fastq --right /home/manager/share1/fastq_normal/SRR850813_2.fastq --CPU 6 --output /home/manager/share1/trinity_AP7_test

Hi, the earlier error was: what(): Failed to allocate 111400196440 bytes of memory Error, cmd: jellyfish count -t 6 -m 25 -s 28921204837 --canonical both.fa died with ret 6 at Can you post the current error message? Is it trying to allocate different amounts of RAM? ~b
On Tue, May 26, 2020 at 8:24 PM wensulin93 @.***> wrote: Hello! @brianjohnhaas Mr.Brain! Thanks for your reply! I have tried the "max_memory 50G" parameter, but it still showed the same
error as before.
…
— You are receiving this because you were mentioned. Reply to this email directly, view it on GitHub, or unsubscribe.
-- -- Brian J. Haas The Broad Institute http://broadinstitute.org/~bhaas

@Wenwen012345
Copy link
Author

And I noticed the initial parameter "--seqtype" should be fq. I revised this mistake; The full command line is the following:
Trinity --seqType fq --max_memory 50G --left /home/manager/share1/fastq_normal/SRR850813_1.fastq --right /home/manager/share1/fastq_normal/SRR850813_2.fastq --CPU 6 --output /home/manager/share1/trinity_AP7_test

Hi, the earlier error was: what(): Failed to allocate 111400196440 bytes of memory Error, cmd: jellyfish count -t 6 -m 25 -s 28921204837 --canonical both.fa died with ret 6 at Can you post the current error message? Is it trying to allocate different amounts of RAM? ~b
On Tue, May 26, 2020 at 8:24 PM wensulin93 @.***> wrote: Hello! @brianjohnhaas Mr.Brain! Thanks for your reply! I have tried the "max_memory 50G" parameter, but it still showed the same
error as before.
…
— You are receiving this because you were mentioned. Reply to this email directly, view it on GitHub, or unsubscribe.
-- -- Brian J. Haas The Broad Institute http://broadinstitute.org/~bhaas

@brianjohnhaas
Copy link
Member

brianjohnhaas commented May 28, 2020 via email

@Wenwen012345
Copy link
Author

OK，got it T_T. However, this is my own personal computer and that's almost the only running softeware... @brianjohnhaas

the error message this time appears to be: what(): Failed to allocate 27567162416 bytes of memory which is ~27G of RAM. If you have much more RAM available, then I'm not sure why this would fail. Perhaps you're competing with resources being used by others on the same hardware...? On Wed, May 27, 2020 at 11:47 PM wensulin93 notifications@github.com wrote:
…
And I noticed the initial parameter "--seqtype" should be fq. I revised this mistake; The full command line is the following: Trinity --seqType fq --max_memory 50G --left /home/manager/share1/fastq_normal/SRR850813_1.fastq --right /home/manager/share1/fastq_normal/SRR850813_2.fastq --CPU 6 --output /home/manager/share1/trinity_AP7_test Hi, the earlier error was: what(): Failed to allocate 111400196440 bytes of memory Error, cmd: jellyfish count -t 6 -m 25 -s 28921204837 --canonical both.fa died with ret 6 at Can you post the current error message? Is it trying to allocate different amounts of RAM? ~b On Tue, May 26, 2020 at 8:24 PM wensulin93 @.***> wrote: Hello! @brianjohnhaas https://github.com/brianjohnhaas Mr.Brain! Thanks for your reply! I have tried the "max_memory 50G" parameter, but it still showed the same error as before. … <#m_-9092570009560521294_> — You are receiving this because you were mentioned. Reply to this email directly, view it on GitHub, or unsubscribe. -- -- Brian J. Haas The Broad Institute http://broadinstitute.org/~bhaas — You are receiving this because you were mentioned. Reply to this email directly, view it on GitHub <#848 (comment)>, or unsubscribe https://github.com/notifications/unsubscribe-auth/ABZRKX2JQVCXMKKPYM7YPOLRTXNGDANCNFSM4NKEAYFQ .
-- -- Brian J. Haas The Broad Institute http://broadinstitute.org/~bhaas http://broad.mit.edu/~bhaas

@brianjohnhaas
Copy link
Member

brianjohnhaas commented May 28, 2020 via email

@Wenwen012345
Copy link
Author

Wenwen012345 commented May 28, 2020 •
edited

Some other probably useful information is that this fastq file is from SRA format. I altered the initial files to fastq format as the quote of the software.

I just found the command line of altering format : /biosoft/sratoolkit/sratoolkit.2.8.2-1-ubuntu64/bin/fastq-dump.2.8.2 --defline-seq '@$sn[_$rn]/$ri/1' --split-files ../SRR850813.SRA > ./SRR850813_1.

If there is some problem, you can figure out that, thank you @brianjohnhaas !

the error message this time appears to be: what(): Failed to allocate 27567162416 bytes of memory which is ~27G of RAM. If you have much more RAM available, then I'm not sure why this would fail. Perhaps you're competing with resources being used by others on the same hardware...? On Wed, May 27, 2020 at 11:47 PM wensulin93 notifications@github.com wrote:
…
And I noticed the initial parameter "--seqtype" should be fq. I revised this mistake; The full command line is the following: Trinity --seqType fq --max_memory 50G --left /home/manager/share1/fastq_normal/SRR850813_1.fastq --right /home/manager/share1/fastq_normal/SRR850813_2.fastq --CPU 6 --output /home/manager/share1/trinity_AP7_test Hi, the earlier error was: what(): Failed to allocate 111400196440 bytes of memory Error, cmd: jellyfish count -t 6 -m 25 -s 28921204837 --canonical both.fa died with ret 6 at Can you post the current error message? Is it trying to allocate different amounts of RAM? ~b On Tue, May 26, 2020 at 8:24 PM wensulin93 @.***> wrote: Hello! @brianjohnhaas https://github.com/brianjohnhaas Mr.Brain! Thanks for your reply! I have tried the "max_memory 50G" parameter, but it still showed the same error as before. … <#m_-9092570009560521294_> — You are receiving this because you were mentioned. Reply to this email directly, view it on GitHub, or unsubscribe. -- -- Brian J. Haas The Broad Institute http://broadinstitute.org/~bhaas — You are receiving this because you were mentioned. Reply to this email directly, view it on GitHub <#848 (comment)>, or unsubscribe https://github.com/notifications/unsubscribe-auth/ABZRKX2JQVCXMKKPYM7YPOLRTXNGDANCNFSM4NKEAYFQ .
-- -- Brian J. Haas The Broad Institute http://broadinstitute.org/~bhaas http://broad.mit.edu/~bhaas

@Wenwen012345
Copy link
Author

Wenwen012345 commented May 28, 2020 •
edited

Thank you very much, Mr.Brain.HAHA^^, I just equiped a new Hard Disk (6T) on my computer.

I have a hard time believing that you've got hundreds of G of RAM on your personal computer. If you do, it must be pretty amazing!
…
On Thu, May 28, 2020 at 9:23 AM wensulin93 @.> wrote: OK，got it T_T. However, this is my own personal computer and that's almost the only running softeware... @brianjohnhaas https://github.com/brianjohnhaas the error message this time appears to be: what(): Failed to allocate 27567162416 bytes of memory which is ~27G of RAM. If you have much more RAM available, then I'm not sure why this would fail. Perhaps you're competing with resources being used by others on the same hardware...? On Wed, May 27, 2020 at 11:47 PM wensulin93 @. wrote: … <#m_-7392918921610715382_> And I noticed the initial parameter "--seqtype" should be fq. I revised this mistake; The full command line is the following: Trinity --seqType fq --max_memory 50G --left /home/manager/share1/fastq_normal/SRR850813_1.fastq --right /home/manager/share1/fastq_normal/SRR850813_2.fastq --CPU 6 --output /home/manager/share1/trinity_AP7_test Hi, the earlier error was: what(): Failed to allocate 111400196440 bytes of memory Error, cmd: jellyfish count -t 6 -m 25 -s 28921204837 --canonical both.fa died with ret 6 at Can you post the current error message? Is it trying to allocate different amounts of RAM? ~b On Tue, May 26, 2020 at 8:24 PM wensulin93 @.***> wrote: Hello! @brianjohnhaas https://github.com/brianjohnhaas https://github.com/brianjohnhaas Mr.Brain! Thanks for your reply! I have tried the "max_memory 50G" parameter, but it still showed the same error as before. … <#m_-9092570009560521294_> — You are receiving this because you were mentioned. Reply to this email directly, view it on GitHub, or unsubscribe. -- -- Brian J. Haas The Broad Institute http://broadinstitute.org/~bhaas — You are receiving this because you were mentioned. Reply to this email directly, view it on GitHub <#848 (comment) <#848 (comment)>>, or unsubscribe https://github.com/notifications/unsubscribe-auth/ABZRKX2JQVCXMKKPYM7YPOLRTXNGDANCNFSM4NKEAYFQ . -- -- Brian J. Haas The Broad Institute http://broadinstitute.org/~bhaas http://broad.mit.edu/~bhaas — You are receiving this because you were mentioned. Reply to this email directly, view it on GitHub <#848 (comment)>, or unsubscribe https://github.com/notifications/unsubscribe-auth/ABZRKXYMRSDUUU4M5BLTZCLRTZQUHANCNFSM4NKEAYFQ .
-- -- Brian J. Haas The Broad Institute http://broadinstitute.org/~bhaas http://broad.mit.edu/~bhaas

@Wenwen012345
Copy link
Author

Wenwen012345 commented May 30, 2020 •
edited

Hello ,@brianjohnhaas !

When I set the "max_memory" parameter to 10G .

However, the original error still exists in the latest running procedure. Could you please give some advice? Thank you!

The latest error is as follows:

CMD: /home/manager/miniconda3/opt/trinity-2.9.1/util/..//util/support_scripts//nbkc_normalize.pl --stats_file pairs.K25.stats --max_cov 200  --min_cov 1 --max_CV 10000 > pairs.K25.stats.C200.maxCV10000.accs
17731677 / 26537763 = 66.82% reads selected during normalization.
0 / 26537763 = 0.00% reads discarded as likely aberrant based on coverage profiles.
0 / 26537763 = 0.00% reads discarded as below minimum coverage threshold=1
CMD finished (736 seconds)
CMD: touch pairs.K25.stats.C200.maxCV10000.accs.ok
CMD finished (0 seconds)
-search and capture.
-preparing to extract selected reads from: /home/manager/share/test/SRR850813_2.fastq ... done prepping, now search and capture.
-capturing normalized reads from: /home/manager/share/test/SRR850813_2.fastq
Error, cmd: /home/manager/miniconda3/opt/trinity-2.9.1/util/insilico_read_normalization.pl --seqType fq --JM 10G  --max_cov 200 --min_cov 1 --CPU 6 --output /home/manager/share/test/trinity_out_dir/insilico_read_normalization --max_CV 10000  --left /home/manager/share/test/SRR850813_1.fastq --right /home/manager/share/test/SRR850813_2.fastq --pairs_together --PARALLEL_STATS   died with ret 9 at /home/manager/miniconda3/bin/Trinity line 2798.
	main::process_cmd("/home/manager/miniconda3/opt/trinity-2.9.1/util/insilico_read"...) called at /home/manager/miniconda3/bin/Trinity line 3348
	main::normalize("/home/manager/share/test/trinity_out_dir/insilico_read_normal"..., 200, ARRAY(0x7fc329f562a8), ARRAY(0x7fc329f562c0)) called at /home/manager/miniconda3/bin/Trinity line 3291
	main::run_normalization(200, ARRAY(0x7fc329f562a8), ARRAY(0x7fc329f562c0)) called at /home/manager/miniconda3/bin/Trinity line 1351

Best!

Sulin

@brianjohnhaas
Copy link
Member

brianjohnhaas commented May 30, 2020 via email

@Wenwen012345
Copy link
Author

Wenwen012345 commented May 30, 2020 •
edited

@brianjohnhaas ,thanks for your reply!
This image reflects my available RAM (It should be visiable,right?).

I used "Hard Diks H" (1.13TB avaliable) as my work directory. You can refer to that.
image

@brianjohnhaas
Copy link
Member

brianjohnhaas commented May 30, 2020 via email

@Wenwen012345
Copy link
Author

Wenwen012345 commented May 30, 2020 •
edited

@brianjohnhaas OK. I'm so sorry that I mixed the concept of "RAM" and "drives" >_<||| ! Thanks for your remind. Thats my big mistake!

My True RAM Is 16G, and the CPU is Intel Core i5-9400F CPU@ 2.90GHz.

I will try to run the software again for a whole procedure. Thanks for help!

Sulin

I don't think that's RAM. Looks like drives.

@brianjohnhaas
Copy link
Member

brianjohnhaas commented May 30, 2020 via email

@Wenwen012345
Copy link
Author

Wenwen012345 commented May 31, 2020 •
edited

OK, Thanks very much @brianjohnhaas ! I ran Trinity again to test. And it report this error as follows. Is this error from the low-level RAM and configuration of my computer (Since I did not see much memory cost in "task management" ; This should be the last question.)?

Error, cmd: jellyfish count -t 6 -m 25 -s 1216298105 --canonical both.fa died with ret 9 at /home/manager/miniconda3/opt/trinity-2.9.1/util/insilico_read_normalization.pl line 793. Error, cmd: /home/manager/miniconda3/opt/trinity-2.9.1/util/insilico_read_normalization.pl --seqType fq --JM 13G --max_cov 200 --min_cov 1 --CPU 6 --output /home/manager/share1/trinity_AP2_test/insilico_read_normalization --max_CV 10000 --left /home/manager/share1/test/SRR850813_1.fastq --right /home/manager/share1/SRR850813_2.fastq --pairs_together --PARALLEL_STATS died with ret 512 at /home/manager/miniconda3/bin/Trinity line 2798. main::process_cmd("/home/manager/miniconda3/opt/trinity-2.9.1/util/insilico_read"...) called at /home/manager/miniconda3/bin/Trinity line 3348 main::normalize("/home/manager/share1/trinity_AP2_test/insilico_read_normaliza"..., 200, ARRAY(0x7faf85667228), ARRAY(0x7faf85667240)) called at /home/manager/miniconda3/bin/Trinity line 3291 main::run_normalization(200, ARRAY(0x7faf85667228), ARRAY(0x7faf85667240)) called at /home/manager/miniconda3/bin/Trinity line 1351

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment
Assignees
No one assigned
Labels
None yet
Projects
None yet
Milestone
No milestone
Development

No branches or pull requests
2 participants
@brianjohnhaas @Wenwen012345