Unofficial CPython binding to LinearFold
Use pip
to install the module.
pip install linearfold-unofficial
You may build from the source code for unsupported Python versions or platforms.
git clone --recursive https://github.com/ChangLabSNU/python-linearfold
cd python-linearfold
pip install .
The module currently only has one function called fold(seq)
, and
it doesn't have any customizable options other than the defaults.
The seq parameter should be an RNA sequence in uppercase letters,
and any T
should be converted to U
before passing it to the function.
>>> import linearfold
>>> seq = 'UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAUGGGCUGUCUGACA'
>>> linearfold.fold(seq)
('((((((((((((((((.(((((.(((((.(((.(((...))))))))))).)))))))))))))))))))))', -34.6)
The function returns a tuple with two elements. The first element is the predicted MFE structure, and the second element is the free energy of the structure in kcal/mol.
Hyeshik Chang <hyeshik@snu.ac.kr>
This Python binding is licensed under the MIT-style license. However, the compiled binary includes code from the LinearFold package, which is licensed for non-commercial use.