Introduction

DHat is an efficient and using easily tool, it intergrate linker filtering, alignment, noise reduce and matrix building.

install
usage

Install

Dependence
Third software: bwa, mafft, python
Python module: matplotlib, scipy, argparse, numpy <= 1.14.2

Install
Before you use DHat you would better install some dependent tools. Please ensure your server can connect to network.
Install Anaconda (Python 2.7 version)

$ wget https://repo.anaconda.com/archive/Anaconda2-2018.12-Linux-x86_64.sh
$ bash ./Anaconda2-2018.12-Linux-x86_64.sh -p ~/

Install mafft and bwa

$ conda install -c bioconda mafft
$ conda install -c bioconda bwa

Install Python module
Note: the version of numpy should be less than 1.14.2

$ pip install matplotlib
$ pip install scipy
$ pip install argparse
$ pip install numpy

Download and install JRE (necessary)
I am not sure the wget command can work well, you would better download JRE from webpage and then upload to server

$ wget https://download.oracle.com/otn-pub/java/jdk/8u201-b09/42970487e3af4f5aa5bca3f542482c60/jre-8u201-linux-x64.tar.gz
$ tar -zxf server-jre-8u201-linux-x64.tar.gz
$ export PATH=jre1.8.0_201/bin/:$PATH

If you don't want to execute the last command after you connect server each time, you can append this command to your file named ".barsh_profile" or use the following command

$ echo 'export PATH=jre1.8.0_201/bin/:$PATH' >> ~/.bash_profile

By now, we have installed all dependence, then you can download DHat.jar from this page. Then, install DHat

$ java -jar DHat.jar install

Usage

Usage: java -jar DHat.jar [options], you can get the all information of command options by java -jar DHat.jar

 -conf <file>         Configure file
 -D,--Debug <int>     Debug Level (default 0)
 -i <file>            input file
 -o,--out <dir>       Out put directory
 -p <string>          Prefix
 -pbs                 running by pbs
 -r,--res <ints>      resolution
 -s,--step <string>   same as "Step" in configure file
 -t,--thread <int>    number of threads

DHat support many options, the most general usage of DHat is:

$ java -jar DHat.jar -conf <configure file>

Note: program will use default path ("path of DHat"/Resource/default.conf or "path of DHat"/Resource/default_adv.conf) if you don't set -conf or -adv

1. Set the configure file

   After install DHat, there are two new directory: Script and Resource. The Script folder include some python script, Resource folder include a template of configure file.

   

   download a test data copy template configure file

   $ cp Resource/default.conf ./test.conf
   

   edit test.conf and set value like following figure

   $ vi test.conf
   

   

   Note: The OutPath you set must be existed.
   Note: If you don't know the HalfLinker or Restriction, you can set these parameters blank. The detail see [Linker detection](#Linker detection).

2. Save your set and execute DHat

   $ java -jar DHat.jar -conf test.conf > log.txt 2> err.txt
   

   Program will print the configure information shortly

---

Configure file

Configure file must keep to the follow format, and the line start with # will been ignored.

#------------------------------required parameters----------------------------  
InputFile = DLO-test.fastq  
GenomeFile = Hg19.clean.fna  
#------------------------------optional parameters---------------------------  
Restriction =   
HalfLinker = 
OutPath = ./  
Prefix = out  
Index = Hg19  
Chromosomes =  
AdapterSeq =  auto
Resolutions = 1000000  
DrawResolutions = 1000000  
Thread = 4  
Step = -  
#------------------------------advance parameters---------------------------  
MatchScore = 1  
MisMatchScore = -1  
InDelScore = -1  
MinLinkerLen =  
MinReadsLength = 16  
MaxReadsLength = 20  
AlignThread = 1  
AlignType = Short  
AlignMisMatch = 0  
MinUniqueScore =
Bwa = bwa
Mafft = mafft
Python = python 
Iteration = true  
DeBugLevel = 0  

explain

InputFile           String      Input File with Fastq Format
GenomeFile          String      Reference genome file
#===============================================================================
Restriction         String      Sequence of restriction, enzyme cutting site expressed by "^"
HalfLinker          String[]    Halflinker sequences (different half-linker separated with a space)
OutPath             String      Path of output  (default    "./")
Prefix              String      prefix of output    (default    "DLO_Out")
Index               String      Index prefix of reference genome
Chromosomes         String[]    Chromosome name must same as Chromosome name in reference genome    (default all in reference genome)
AdapterSeq          String[]    Adapter sequence, null means don't remove adapter   (default    "")
                                If you want to remove adapter but you don't know the adapter seq, you can set "Auto"
Resolutions         Int[]       Bin size when create interaction matrix  (default    "1000000" byte)
DrawResolution      Int[]       Resolution for you draw heat-map    (default    "100000")
Thread              Int         Number of threads    (default    "4")
Step                String[]    assign  where start and end (default    "-")
#===============================================================================
MatchScore          Int         Match score in linker filter    (default    "1")
MisMatchScore       Int         MisMatch Score in linker filter (default    "-1")
InDelScore          Int         Indel Score in linker filter    (default    "-1")
MinLinkerLen        Int         Minimum linker length
MinReadsLength      Int         Min reads length when extract interaction reads (default    "16")
MaxReadsLength      Int         Max reads length when extract interaction reads (default    "20")
AlignType           String      Reads type include ["Short","Long"] (default    "Short")
AlignMisMatch       Int         MisMatch number in alignment    (default    "0")
MinUniqueScore      Int         Minimum mapQ what reads mapQ less than it will be removed
Bwa                 String      The path of bwa execute file (include the execute file)
Mafft               String      The path of mafft execute file (include the execute file)
Python              String      The path of Python execute file (include the execute file)
Iteration           Bool        "true" or "false" represent whether do iteration alignment
DeBugLevel          Int         0 means remain base output, 1 means more output, 2 means all output (default    "0")

Note: If we set ReadsType "Short", we will align with bwa aln,and if set "Long",we will align with bwa mem.
Note: Step include "PreProcess" "Alignment" "Bed2BedPe" "NoiseReduce" "BedPe2Inter" "CreateMatrix"
Note: If we want to run from "Alignment" to "CreateMatrix", we can set "Alignment - CreateMatrix"
Note: If we only want to run from "Alignment" to end, we can set "Alignment -"
Note: If we want to run all, we can set "-"

Other Script

java -cp DHat.jar Bin.Guide  //use GUI
java -cp DHat.jar Utils.BedToBedpe
java -cp DHat.jar Utils.CalculateLineNumber
java -cp DHat.jar Utils.CreateMatrix
java -cp DHat.jar Utils.FastqExtract
java -cp DHat.jar Utils.PetCluster
java -cp DHat.jar Utils.RangeCount
java -cp DHat.jar Utils.SamFilter
java -cp DHat.jar Utils.PlotHeatMap
java -cp DHat.jar Utils.MatrixCorrelation
java -cp DHat.jar Component.tool.Annotation
java -cp DHat.jar Component.tool.LinkerDetection

Linker detection

If you don't know the value of parameter Restriction or HalfLinker, you can try to use the follow methods.

1. use java -cp DHat.jar Component.tool.LinkerDetection
   usage: java -cp DHat.jar Component.tool.LinkerDetection -i <input file> [options]
   argument

   -i      input file (fastq or fastq.gz format)
   -e      restriction sequence such as A^AGCTT (default 'autiomatic detection', 
           if you don't want to detect restriction sequence, please set 'no')
   -f      threshold (default 0.05, highter value means less data remain)
   -k      k-mer length (default 10)
   -n      sequence number use to processing (default 5000)
   

   result
   The first line is restriction sequence, following is linker sequence, orientation and minimum kmer overlap

   C^CGG
   CGTCGGATTAGGTGTATCTAGATACACCTAATCCGACG	+	760.0
   CGTCGGAGAACCAGTAGCTAGCTACTGGTTCTCCGACG	+	800.0
   

2. set "Restriction" or "HalfLinker" empty.
   for example

   Restriction = 
   HalfLinker =