LinearPartition: Linear-Time Approximation of RNA Folding Partition Function and Base Pairing Probabilities
This repository contains the C++ source code for the LinearPartition project, the first linear-time partition function and base pair probabilities calculation algorithm/software for RNA secondary structures.
LinearPartition: linear-time approximation of RNA folding partition function and base-pairing probabilities. Bioinformatics, Volume 36, Issue Supplement_1, July 2020, Pages i258–i267. ISMB 2020
He Zhang, Liang Zhang, David Mathews, Liang Huang*
* corresponding author
Web server: http://linearfold.org/partition
Dependencies
gcc 4.8.5 or above; python2.7 LaTex for drawing circular plot numpy, pandas, seaborn and matplotlib for drawing heatmap plot
To Compile
make
To Run
LinearPartition can be run with:
echo SEQUENCE | ./linearpartition [OPTIONS]
OR
cat SEQ_OR_FASTA_FILE | ./linearpartition [OPTIONS]
Both FASTA format and pure-sequence format are supported for input.
OPTIONS:
--beamsize BEAM_SIZE or -b BEAM_SIZE
The beam size (default 100). Use 0 for infinite beam.
--Vienna or -V
Switches LinearPartition-C (by default) to LinearPartition-V.
--fasta
Specify that the input is in fasta format. (default FALSE)
--verbose
Prints out beamsize, Log Partition Coefficient or free energy of ensemble (-V mode) and runtime information. (default False)
--sharpturn
Enable sharpturn. (default False)
--output FILE_NAME or -o FILE_NAME
Outputs base pairing probability matrix to a file with user specified name. (default False)
--rewrite FILE_NAME or -r FILE_NAME
Output base pairing probability matrix to a file with user specified name (overwrite if the file exists). (default False)
--prefix PREFIX_NAME
Outputs base pairing probability matrices to files with user specified prefix. (default False)
--part or -p
Partition function calculation only. (default False)
--cutoff CUTOFF or -c CUTOFF
Only output base pair probability larger than user specified threshold (CUTOFF) between 0 and 1. (DEFAULT=0.0)
--dumpforest or -f
dump forest (all nodes with inside [and outside] log partition functions but no hyperedges) for downstream tasks such as sampling and accessibility (DEFAULT=None)
--mea or -M
get MEA structure, (DEFAULT=FALSE)
--gamma GAMMA or -g GAMMA
set MEA gamma, (DEFAULT=3.0)
--bpseq
output MEA structure(s) in bpseq format instead of dot-bracket format
--mea_prefix
output MEA structure(s) to file(s) with user specified prefix name
--threshknot or -T
get ThreshKnot structure, (DEFAULT=FALSE)
--threshold <FILE_NAME>
set ThreshKnot threshknot, (DEFAULT=0.3)
--threshknot_prefix
output ThreshKnot structure(s) to file(s) with user specified prefix name (default False)
--shape FILE_NAME
use SHAPE reactivity data (for -V mode only)
Please refer to this link for the SHAPE data format:
https://rna.urmc.rochester.edu/Text/File_Formats.html#SHAPE
To Visualize
LinearPartition provides two ways to visualize base pairing probabilities, circular plot and heatmap plot.
In a circular plot, the darkness of each arc represents the probability of each base pair (see an example below). To draw a circular plot, run command:
cat TARGET_FILE | ./draw_bpp_plot BASE_PAIRING_PROBABILITY_FILE
TARGET_FILE contains one sequence and its structure; see "ecoli_tRNA" file as an example. BASE_PAIRING_PROBABILITY_FILE can be a probability file generated by LinearPartition, or a file with the same format; see "ecoli_tRNA_bpp" as an example.
To draw a heatmap plot, run command:
cat BASE_PAIRING_PROBABILITY_FILE | ./draw_heatmap SEQUENCE_LENGTH
SEQUENCE_LENGTH is the length of the sequence.
Example: Run Predict
cat testseq | ./linearpartition -V --prefix testseq_output
Free Energy of Ensemble: -1.96 kcal/mol
Outputing base pairing probability matrix to testseq_output_1...
Done!
Free Energy of Ensemble: -9.41 kcal/mol
Outputing base pairing probability matrix to testseq_output_2...
Done!
Free Energy of Ensemble: -7.72 kcal/mol
Outputing base pairing probability matrix to testseq_output_3...
Done!
Free Energy of Ensemble: -9.09 kcal/mol
Outputing base pairing probability matrix to testseq_output_4...
Done!
Free Energy of Ensemble: -13.58 kcal/mol
Outputing base pairing probability matrix to testseq_output_5...
Done!
echo GGGCUCGUAGAUCAGCGGUAGAUCGCUUCCUUCGCAAGGAAGCCCUGGGUUCAAAUCCCAGCGAGUCCACCA | ./linearpartition -o output
Log Partition Coefficient: 15.88268
Outputing base pairing probability matrix to output...
Done!
Example: Run Partition Function Calculation Only
echo GGGCUCGUAGAUCAGCGGUAGAUCGCUUCCUUCGCAAGGAAGCCCUGGGUUCAAAUCCCAGCGAGUCCACCA | ./linearpartition -V -p --verbose
beam size: 100
Free Energy of Ensemble: -32.14 kcal/mol
Partition Function Calculation Time: 0.01 seconds.
Example: Run Prediction and Output MEA structure
echo GGGCUCGUAGAUCAGCGGUAGAUCGCUUCCUUCGCAAGGAAGCCCUGGGUUCAAAUCCCAGCGAGUCCACCA | ./linearpartition -V -M
Free Energy of Ensemble: -32.14 kcal/mol
GGGCUCGUAGAUCAGCGGUAGAUCGCUUCCUUCGCAAGGAAGCCCUGGGUUCAAAUCCCAGCGAGUCCACCA
(((((((..((((.......))))((((((((...)))))))).(((((.......))))))))))))....
Example: Run Prediction and Output ThreshKnot structure in bpseq format
echo GUUGUUAUAGCAUAAGAAGUGCAUUUGUUUUAAGCGUAAAAGAUAUGGGACAACUCCA | ./linearpartition -V -T --threshold 0
Free Energy of Ensemble: -8.74 kcal/mol
GUUGUUAUAGCAUAAGAAGUGCAUUUGUUUUAAGCGUAAAAGAUAUGGGACAACUCCA
1 G 54
2 U 53
3 U 52
4 G 51
5 U 50
6 U 49
7 A 0
8 U 0
9 A 0
10 G 22
11 C 21
12 A 20
13 U 19
14 A 0
15 A 0
16 G 0
17 A 0
18 A 0
19 G 13
20 U 12
21 G 11
22 C 10
23 A 0
24 U 34
25 U 33
26 U 45
27 G 44
28 U 43
29 U 42
30 U 41
31 U 40
32 A 37
33 A 25
34 G 24
35 C 47
36 G 46
37 U 32
38 A 0
39 A 0
40 A 31
41 A 30
42 G 29
43 A 28
44 U 27
45 A 26
46 U 36
47 G 35
48 G 0
49 G 6
50 A 5
51 C 4
52 A 3
53 A 2
54 C 1
55 U 0
56 C 0
57 C 0
58 A 0
Example Run LinearPartition with SHAPE data
echo GCCUGGUGACCAUAGCGAGUCGGUACCACCCCUUCCCAUCCCGAACAGGACCGUGAAACGACUCCGCGCCGAUGAUAGUGCGGAUUCCCGUGUGAAAGUAGGUCAUCGCCAGGC | ./linearpartition -V --shape example.shape
Free Energy of Ensemble: -67.82 kcal/mol
Example: Draw Circular Plot
cat ecoli_tRNA | ./draw_bpp_plot ecoli_tRNA_bpp
Example: Draw Heatmap Plot
cat ecoli_tRNA_bpp | ./draw_heatmap 76
References
Liang Zhang, He Zhang, David H Mathews, and Liang Huang*. Threshknot: Thresholded probknot for improved RNA secondary structure prediction. arXiv preprint arXiv:1912.12796.
* corresponding author