w4CSeq: software and web application to analyze 4C-Seq data

w4CSeq applies a customized pipeline to deal with both enzyme digestion and sonication fragmentation based 4C-Seq data. It identifies 4C sites, statistically significant regions, draws interacting plots for intra-chromosomal and inter-chromosomal interactions, and overlays genomic features (TSS, TTS, CpG sites), DNA replication timing and user-provided annotation onto it. The combined plots will help uncover significant features in/around 4C regions.

Features

• Web server with simple input specification and multiple outputs.
• Users can download the software and install their own servers in a local environment, or use command line to perform analysis.
• Able to analyze 4C-Seq data generated by both enzyme-digestion and sonication-fragmentation methods.

Usage

1. Server

demo web server

• We provide a demo server w4CSeq for you to examine. Please note that the "Example" page no longer has the example files since we were not able to retrieve a backup from archive. However, you can download the GitHub repository and perform analysis without problem.

build your own server

a. Download and Install

Users can download the cutting edge version from GitHub by git clone git@github.com:WGLab/w4CSeq.git.

b. Software prerequisite

The following softwares should be installed in your cluster before you build server or run w4CSeq command line.

• R (Packages: RCircos, quantsmooth)
• Perl (Module: Math::CDF, List::Util)
• BWA
• SAMtools
• BEDTools

c. Build lib directory

To build the required lib directory, users can download lib.tar.gz file from here. (Please note that this link is updated recently, since the previous URL in this page no longer works.) Then extract files under /w4cseq/ directory by tar -zxvf lib.tar.gz -C /PATH/TO/w4cseq/. After that, there will be four sub-directories (bin, cgi-bin, html, lib) under /w4cseq/, and four sub-sub-directories (hg19, hg18, mm10, and mm9) under /w4cseq/lib/.

Each sub-directory (hg19, hg18, mm10, and mm9) under /w4cseq/lib/ consists of genome sequence and index files (for BWA alignment); annotation files for TTSs, TSSs, CpG sites and genes; reduced library of genome-wide enzyme recognition sites; DNA replication timing annotation files; and cytoband definition file.

d. Specify paths of softwares in program

• Enzyme-digestion based 4C-Seq

  • In 4C_enzyme.Runder /w4cseq/bin/, 1) specify the following (path_w4CSeq, path_bwa, path_samtools, path_bedtools, path_RCircos, path_quantsmooth), representing your paths to w4CSeq, BWA, SAMtools, BEDTools, RCircos and quantsmooth respectively; 2) specify your interpreter in the very first #! line.
  • In Enzyme.cgi under /w4cseq/cgi-bin/ and control_w4cseq_enzyme.pl under /w4cseq/bin/, specify the following ($CARETAKER, $SERVER_DIRECTORY, $WEBSITE), representing email of housekeeper, path to w4CSeq, and assigned website address for your server respectively.

• Sonication-digestion based 4C-Seq

  • In 4C_sonication.Runder /w4cseq/bin/, 1) specify the following (path_w4CSeq, path_bwa, path_samtools, path_bedtools, path_RCircos, path_quantsmooth); 2) specify your interpreter in the very first #! line.
  • In Sonication.cgi under /w4cseq/cgi-bin/ and control_w4cseq_sonication.pl under /w4cseq/bin/, specify the following ($CARETAKER, $SERVER_DIRECTORY, $WEBSITE).

Once these are set up, the server is ready to go.

2. Command line

We recommend you build your own server since it will take input and yield output in an automated manner. Alternatively, you can use one-line command to analyze your 4C-Seq data.

a. Complete the a, b, and c steps in 1. Server section.

b. We suggest you perform all analysis under /w4cseq/work/ directory (if it doesn't exist, creat one by mkdir /w4cseq/work), and set separate subdirectory to store outputs for each analysis for clean organization.

• Enzyme digestion based 4C-Seq data analysis

In enzyme_config.runder /w4cseq/bin/, 1) specify the following (path_w4CSeq, path_bwa, path_samtools, path_bedtools, path_RCircos, path_quantsmooth); 2) specify your interpreter in the very first #! line; 3) specify the following parameters:

1. proc: number of threads. 1 by default and applicable to BWA alignment
2. exp_name: name of folder to create and store files
3. file_in: path to the raw fastq file
4. unzip: whether your data is uncompressed ("yes"/"no")
5. build: reference genome
6. primer_frag: primer sequence for bait region
7. enzyme: recognition sequence for primary restriction enzyme
8. bait_ch: bait chromosome
9. bait_st: starting position of primer pair
10. bait_en: ending position of primer pair
11. size_inter: bin size for trans chromosome (count of enzyme sites in foreground window)
12. size_intra: bin size for cis chromosome (count of enzyme sites in foreground window)
13. window_intra: window size for cis chromosome (count of enzyme sites in background window)
14. FDR: FDR threshold

In count_sites_binomial.pl under /w4cseq/bin/scripts/, 1) specify your interpreter in the very first #! line, such as #!/usr/bin/perl; 2) specify the directory in which your perl modules are installed.

Then run the command line as follows (enzyme_config.r will be sourced automatically):

4C_enzyme_cmdline.R

• Sonication fragmentation based 4C-Seq data analysis

In sonication_config.r under /w4cseq/bin/, 1) specify the following (path_w4CSeq, path_bwa, path_samtools, path_bedtools, path_RCircos, path_quantsmooth); 2) specify your interpreter in the very first #! line; 3) specify the following parameters:

1. proc: number of threads. 1 by default and applicable to BWA alignment
2. exp_name: name of folder to create and store files
3. file_in1: path to the paired end raw fastq files #1
4. file_in2: path to the paired end raw fastq files #2
5. unzip: whether your data is uncompressed ("yes"/"no")
6. build: reference genome
7. bait_ch: bait chromosome
8. bait_st: starting position of primer pair
9. bait_en: ending position of primer pair
10. extend: Extended length from end of primer pair to define "bait" neighborhood
11. size_inter: bin size for trans chromosome (bp length in foreground window)
12. size_intra: bin size for cis chromosome (bp length in foreground window)
13. window_intra: window size for cis chromosome (bp length in background window)
14. FDR: FDR threshold

In positive_region_binomial.pl under /w4cseq/bin/scripts/, 1) specify your interpreter in the very first #! line, such as #!/usr/bin/perl; 2) specify the directory in which your perl modules are installed.

Then run the command line as follows (sonication_config.r will be sourced automatically):

4C_sonication_cmdline.R

Output

w4CSeq provides multiple outputs for you. Please refer to demo result for enzyme-digestion based 4C-Seq result and demo result for sonication-fragmentation based 4C-Seq result.

If you use command line tool to analyze data, output files are deposited in the sub-directory you specified. The descriptions for important files are listed below.

Enzyme-digestion based 4C-Seq

Tabular files:

1. DISTAL_INTERACTION_SITES.bed: This file contains all the restriction sites that have interaction signals covered. The first three columns characterize the location of a covered restriction site and the fourth column is the number of reads mapped there.
2. DISTAL_INTERACTION_SITES_pValue.bed: This file contains the restriction sites with the fourth column representing the p-values after modeling.
3. DISTAL_INTERACTION_SITES_pValue_adjusted.bed: This file contains the restrction sites with the fourth column representing the p-values adjusted using BH/FDR method.
4. positive_hits.bed: This file contains the interaction sites with adjusted p-value less than specified significance threshold (e.g. 0.05). Note that sites within 1Mb range of bait region are not considered as they usually represent highly intense local interactions with extremely small p-values.
5. SIGNIFICANT_REGIONS.bed: This file contains significant regions where neighbouring significant sites are merged. (Each site is extended into a window with size of size_inter (trans) or size_intra (cis). Those sites with overlapping windows are merged into domains and boundaries of domains are documented.)

Files for visualization in genome browsers:

1. MAPPED_BAM.bam: File of mapped reads. Note that it contains PCR artifacts so caution need to be exercised. MAPPED_BAM.bam.bai is the index file required to be loaded together with the bam file.
2. UCSC_view.bed: File characterizing raw reads pile-up. It can be examined in UCSC genome browser.
3. window.bed: File characterizing the captured sites summed in smoothing window. It can be examined in UCSC genome browser.

Figures:

1. genome.png\pdf: Genome wide‐distribution of 4C regions as indicated by red rectangles on top of chromosome ideogram.
2. circos.png\pdf: Circos plot of genome‐wide distribution of 4C interactions as indicated by curves extended from the "bait" region. Intra-chromosomal (cis) and inter-chromosomal (trans) interactions are shown in red and blue, respectively.
3. spider.png\pdf: Spider plot depicting contacts centered on the "bait" region.
4. domainogram.png\pdf: Domainogram depicting interaction intensities across window size ranging from 2 to 200 restriction sites.
5. distance.png\pdf: Density curve showing relative distance of 4C sites from key genomic features including reference genes, TSSs, TTSs and CpG islands compared to random.
6. DNA_replication.png\pdf: Box plot showing the distribution of DNA replication timing values of 4C regions compared to the whole genome in 10 pluripotent cell lines. Early replication domains have the logarithm of replication timing ratio > 0.

Sonication fragmentation based 4C-Seq

The set of files generated is quite similar to that in enzyme-digestion based 4C-Seq analysis.

Tabular files:

1. DISTAL_INTERACTION_SITES.bed: This file contains all the genomic sites that have interaction signals covered. The first three columns characterize the location of a covered site and the fourth column is the number of reads mapped there.
2. paired_end_dist_sort_merge_filter2_Z.bed: This file contains the interaction sites with the fourth column representing the p-values after modeling.
3. DISTAL_INTERACTION_SITES_pValue_adjusted.bed: This file contains the interaction sites with the fourth column representing the p-values adjusted using BH/FDR method.
4. positive_hits.bed: This file contains the interaction sites with adjusted p-value less than specified significance threshold (e.g. 0.05).
5. SIGNIFICANT_SITES.bed: This file contains (1) interaction sites with adjusted p-value less than specified significance threshold as in positive_hits.bed; and (2) neighbouring sites within the range of size_inter (trans) or size_intra (cis) from each significant site.
6. SIGNIFICANT_REGIONS.bed: This file contains regions merged from SIGNIFICANT_SITES.bed. Those sites overlapping within windows of size_inter (trans) or size_intra (cis) are merged into domains and boundaries of domains are documented.

Files for visualization in genome browsers:

1. MAPPED_BAM.bam: File of mapped reads. Note that it contains PCR artifacts so caution need to be exercised. MAPPED_BAM.bam.bai is the index file required to be loaded together with the bam file.
2. UCSC_view.bed: File characterizing raw reads pile-up. It can be examined in UCSC genome browser.
3. window.bed: File characterizing the captured sites summed in smoothing window. It can be examined in UCSC genome browser.

Figures:

1. genome.png\pdf: Genome wide‐distribution of 4C regions as indicated by red rectangles on top of chromosome ideogram.
2. circos.png\pdf: Circos plot of genome‐wide distribution of 4C interactions as indicated by curves extended from the "bait" region. Intra-chromosomal (cis) and inter-chromosomal (trans) interactions are shown in red and blue, respectively.
3. distance.png\pdf: Density curve showing relative distance of 4C sites from key genomic features including reference genes, TSSs, TTSs and CpG islands compared to random.
4. DNA_replication.png\pdf: Box plot showing the distribution of DNA replication timing values of 4C regions compared to the whole genome in 10 pluripotent cell lines. Early replication domains have the logarithm of replication timing ratio > 0.

Fore more information on the parameters settings and other, see here.

FAQ

Q: Why did my job fail?

A: There might be several reasons. Please check the following list.

1. Make sure you input correct parameters. For example, how do you provide DNA sequence of 4C target region?

(1) Suppose chromatin is fragmented with HindIII, your bait primer ATCTGCTATTGAGGAAGCTT should contain a HindIII cutting site AAGCTT at 3' end. Then you should input the DNA sequence ATCTGCTATTGAGGAAGCTT. The analysis cannot be performed if you input ATCTGCTATTGAGG or AAGCTTCCTCAATAGCAGAT.

(2) Check the first a few lines in your fastq files by head (head your_input_name.fastq or gunzip -c your_input_name.fastq.gz | head), to see whether the majority of reads start with the primer sequence you provide (ATCTGCTATTGAGGAAGCTT).

2. In new samtools version, the sort command has changed to samtools sort -o enzyme_sorted.bam bam_file. So you have to change system(paste(path_samtools, "/samtools sort ", file_bam, " enzyme_sort", sep="")) in 4c_enzyme_cmdline.R to system(paste(path_samtools, "/samtools sort -o enzyme_sort.bam ", file_bam, sep="")).

3. If you use bedtools prior to v. 2.20.0, -n is used to count the number of features merged. After v.2.20.0, bedtools merge uses -c and -o operations to achieve that goal. (The pipeline uses 2.25.0.) So if you installed an old version bedtools, you need to change system(paste(path_bedtools, "/mergeBed -i all_reads.bed -c 1 -o count -d 0 > ", file_sort_merge_bed, sep="")) to system(paste(path_bedtools, "/mergeBed -i all_reads.bed -n -d 0 > ", file_sort_merge_bed, sep="")).

Contact

Mingyang Cai (caimingyang08nju@gmail.com) and Kai Wang (kaichop@gmail.com)

Reference

Cai et al. w4CSeq: software and web application to analyze 4C-seq data. Bioinformatics, 32(21):3333–3335, https://doi.org/10.1093/bioinformatics/btw408

More

• w4CSeq Homepage
• Wang Genomics Lab Homepage