Proposal to split B.1.640 into two sublineages

[thomasppeacock]

In a similar vein to the recent split of B.1.1.529(Omicron) into two sister sublineages it appears B.1.640 may also have a similar issue with a major group constating of the vast majority of sequences and a small outgroup which appears related but has a very different set of mutations (EPI_ISL_7181977; EPI_ISL_7156959; EPI_ISL_7156955; EPI_ISL_6315910; EPI_ISL_5926666) and includes sequences from France and England, indicating some degree of spread.

Defining mutations (mutations not shared between both groups shown in bold):
Major lineage:
Spike - P9L, E96Q, Δ136-144, R190S*, I210T, R346S, N394S, Y449N, F490R, N501Y, D614G, P681H, T859N, D936H
Non-spike - NSP2 – P129L, E272G; NSP3 – L1301F, A1537S; NSP4 – S386F, R401H, T492I; NSP6 – V149A; NSP12 – P323L; T32I, Q57H; M – I82T; ORF8 – Q27*STOP; N- D22Y, T205I, E378Q; S2m deletion

Minor lineage:
Spike - P9L, E96Q, Δ136-144, R190S, D215H, R346S, N394S, Y449N, E484K, F490S, N501Y, D614G, P681H, T859N, D1139H
Non-spike - NSP2 – P129L; NSP4 – D459N; NSP6 – Δ106-108, T181I; NSP12 – P323L; NSP13 – V371A; NSP14 – P46S, V437F; ORF3a – T32I, Q57H; M – I82S; ORF8 – Q27*STOP; N – D22Y, T205I

Phylogenetic evidence:

https://nextstrain.org/fetch/genome.ucsc.edu/trash/ct/singleSubtreeAuspice_genome_58c3_f65be0.json?c=pango_lineage&label=nuc%20mutations:C10029T,G23012A,A23063T,C23604A,A26492T,C27925A,C28005T,C28093T,C28887T

Proposed name(s): B.1.640.1 and B.1.640.2?

[thomasppeacock]

Another cluster of sequences from the minor sublineage uploaded from the Provence-Alpes-Cote d Azur region by Colson et al:
EPI_ISL_7314302
EPI_ISL_7314417
EPI_ISL_7314471
EPI_ISL_7314514

[sanschiffre]

Two more sequence from the minor group are coming by Colson et al.

If this help :

Commun mutations with Major Group :
C241T, C3037T, C14408T, A23403G, G25563T, C2416T,
C1191T, C2455T, C11956T, C16869T, C21588T, G21848C, TTTGTAATGATCCATTTTTGGGTGTTTA21966T, G22132T, A22600C, A22743G, T22907A, A23063T, C23604A, C24138A, C25487T, C27513T, C27807T, C27972T, TA28270T, G28337T, C28887T, T29377C, G29779T

Specific to the minor clade :
G9929A, T10561C, GTCTGGTTTT11287G, C11514T, C17004T, T17348C, A17916G, C18175T, C18804T, G19348T, T19680C, A21258G, G22205C, G23012A, T23031C, G24977C, T26767G, T27833C, T28002C, C28312T

[chrisruis]

Thanks @thomasppeacock Agree this split sounds sensible and we've added lineages B.1.640.1 ("Major group" above) and B.1.640.2 ("Minor group" above) in v1.2.108. With this update, there aren't currently any sequences designated to the parental B.1.640 lineage

[PhilippeColson]

We indeed have several cases of this new variant in the Marseille geographical area. We named it "Variant IHU". Two new genomes have jsut been submitted.
Best regards.

[mattdmem]

Hello - Just checking - should it be expected that pangolin now calls B.1.640.1 and B.1.640.2? I don't see any of these in GISAID (just B.1.640) and downloading them all and running an up to date version of pangolin and submodules calls them all B.1.640?

[chrisruis]

Hi @mattdmem I don't think they're in the current pangolin yet as the latest pangoLEARN was trained on v1.2.106 and B.1.640.1 and B.1.640.2 weren't added until v1.2.108. There's likely to be a new pangoLEARN run very soon that will have these in

[thomasppeacock]

Just a small update here - @c19850727 just pointed out to me a further outlier sequence (EPI_ISL_8428057 uploaded by Coppens et al from Belgium). This sequence is really interesting as it contains both unique mutations and elements of both B.1.640.1 and B.1.640.2 (in a similar manner to the relationship between BA.3 to BA.1/2). Only a single sequence at the moment but worth being aware of.

Spike: P9L, T95I, E96Q, Δ136-144, R190S,I210T(.1-like), R346S, N394S, Y449N,E484K (.2-like), F490S (.2-like), Q498R, N501Y, D614G, P681H, T859N, D936H (.1-like), D1139H (.2-like), L1200F
Non-spike: NSP1 – D139G; NSP2 – P129L, A318V; NSP3 – G171C, K412N, A1537S(like .1), A1642V; NSP4 – L276V, V294L; D459N (.2-like); NSP5 – P241S; NSP6 – Δ106-108(.2-like); NSP7 – E73D; NSP9 – V102I; NSP12 – P323L; ORF3a – T32I, Q57H, S171L; M -I82T (.1-like); ORF8 – Q27*STOP; N – D22Y, I94V, T205I, E378Q (.1-like)

https://nextstrain.org/fetch/genome.ucsc.edu/trash/ct/subtreeAuspice1_genome_1bab9_84a570.json?c=pango_lineage_usher&tl=pango_lineage

[c19850727]

EPI_ISL_8525350 found another one from Belgium.