Bayesian reconstruction of ancient DNA fragments
C++ Other
Switch branches/tags
Nothing to show
Clone or download
Fetching latest commit…
Cannot retrieve the latest commit at this time.
Permalink
Failed to load latest commit information.
bamtools @ 48233a2
libgab @ 2789928
src
testData
.gitmodules
.travis.yml
LICENSE
Makefile
README.md

README.md

leeHom: Bayesian reconstruction of ancient DNA fragments

QUESTIONS: gabriel [dot] reno [ at sign ] gmail.com

About

leeHom is a program for the Bayesian reconstruction of ancient DNA (the binary is mergeTrimReadsBAM).

Downloading:

Go to https://github.com/grenaud/leeHom and do one of the following:

  1. Clone the repository: git clone --recursive https://github.com/grenaud/leeHom.git
  2. Download the ZIP archive and then manually download the submodules

Installation:

Make sure you have cmake installed. If required, install it by typing apt-get install cmake for Ubuntu for example.

  1. Build the submodules and main code by typing :

    make

Running the program:

To launch the program simply type:

src/leeHom

or for if you have a multi-core machine, you can use them using the -t option in the following multi-threaded program:

src/leeHomMulti

Interpreting the output using the fastq mode

If the input is fastq, the output will also be fastq. Normally you will get different files. Here is a table explaining their meaning/content. The [PREFIX] is the output prefix specified using -fqo.

Single-end mode:

File suffix Meaning
[PREFIX].fq.gz Sequences that were either trimmed or untrimmed confidently by leeHom
[PREFIX].fail.fq.gz Sequences where the most likely original sequence length was not several fold more likely than the second most likely sequence length. The most likely sequence length is are nonetheless found in the file.

Paired-end mode:

File suffix Meaning
[PREFIX].fq.gz Sequences that were trimmed and merged confidently by leeHom
[PREFIX]_r1.fq.gz Forward reads that were neither trimmed nor merged confidently by leeHom
[PREFIX]_r2.fq.gz Reverse reads that were neither trimmed nor merged confidently by leeHom
[PREFIX].fail.fq.gz Sequences that were trimmed and merged by leeHom and where the most likely original sequence length was not several fold more likely than the second most likely sequence length
[PREFIX]_r1.fail.fq.gz Forward reads that were neither trimmed nor merged by leeHom and where the most likely original sequence length was not several fold more likely than the second most likely sequence length
[PREFIX]_r2.fail.fq.gz Reverse reads that were neither trimmed nor merged by leeHom and where the most likely original sequence length was not several fold more likely than the second most likely sequence length

Interpreting the log messages

By default, leehom prints a log messsage to stderr. leehom counts 2 paired-end reads or one single-end read as one cluster. This is how to interpret the log:

Field Meaning
Total Total number of clusters analyzed by leehom
Merged (trimming) Number of clusters where the adapter was found and, for paired-end reads, a likely overlap between the forward and reverse reads was found
Merged (overlap) When using a prior or --ancientdna and paired-end data, the number of clusters where an likely overlap between the ends of paired-end reads was found and reads were merged as a single molecule
Kept PE/SR Cluster where no sufficient evidence for merging paired-end or trimming single-end reads was found
Trimmed SR When using single-end reads, the number of reads where a match to the adapter was found
Adapter dimers/chimeras Number of cluster where a chimeric sequence (two adapters merged together without insert) was found and were flagged as QC failed
Failed Key If the user provides a key (sequences must start with this sequences is it was part of the adapter and not covered by the sequencing primer) the number of clusters where the key was not found will be reported here.

How / When to set a prior?

If you have previous data and have a representative sample of reasonable size for your library, using a prior will give you the best reconstruction possible. leehom models the distribution as a log-normal one. To infer the parametes of the log-normal distribution, you can use src/approxDist.R to get the parameters and use those as prior in leehom. To create this data from aligned modern DNA or (preferably aligned) pre-trimmed ancient, you can launch the following command on the BAM file:

samtools view aligned.bam | gawk 'and($2,5)==0 { print length($10) }; and($2,2)==2 && $9>0 { print $9 }' | gzip  > sizedata.dat.gz

(We recommend the use of this command with BWA especially as it uses the properly paired flag).

Given that the resulting file has one molecule length per line. You can use the following R script to get the maximum likelihood parameters for the log-normal distribution:

src/approxDist.R testData/sizedata.dat.gz
Loading required package: survival
Loading required package: splines
     meanlog         sdlog
  5.1444983185   0.2885764766
 (0.0009125589) (0.0006452766)

The first number (5.1444983185) represents the "Location" for log-normal distribution whereas the second number (0.2885764766) represents the "Scale". Those parameters can now be used in leehom as --loc 5.1444983185 --scale 0.2885764766.

If you have no previous data, you can launch leehom using a uniform prior (default parameters). If you have modern DNA with relatively long insert sizes, you can use leehom as is. If you have ancient DNA and/or suspect that molecules are short, use the --ancientdna which will merge reads that share only a partial overlap if they have sufficient probabilistic support.

What if the adapters are stored in fasta files?

You can use a file descriptor for each. For example if they are stored as FASTA:

src/leeHom -f `cat /mydata/forward.fa | tail -n+2 | tr -d "\n"` -s `cat /mydata/reverse.fa | tail -n+2 | tr -d "\n"`

How do I get the sequence of the adapters?

Contact your sequencing center or core and ask them to send you the sequence of the sequencing adapters. They should be known in advance since, currently, leehom cannot infer the sequence but uses this information as a prior.

Does my BAM file have to be in a specific order?

For single-end, no. For paired-end, mate have to be consecutive in the file (i.e. First mate 1, second mate 1, First mate 2, second mate 2, etc.. ). This can be done by either using raw data from the sequencer or sorting by name.

Does my BAM file have to be unmapped?

BAM files can also be used to store unmapped reads. Ideally, leehom should be used prior to mapping since reads will map to a more accurate location if the adapters have been removed and overlapping stretches have been merged.

What do the FF tags in the BAM file mean?

Here is a table with the meaning for each FF flag:

FF Meaning
1 single-end reads trimmed
2 paired-end merged overlapping portions
3 paired-end trimmed and merged overlapping portions

Test data:

A small test set of 50,000 ancient DNA sequences from the Altai Neandertal can be found here: testData/rawAncientDNA.bam

To launch the reconstruction program for this test data set, use the following command:

src/leeHom -f AGATCGGAAGAGCACACGTCTGAACTCCAG -s GGAAGAGCGTCGTGTAGGGAAAGAGTGTAG --ancientdna -o testData/reconsAncientDNA.bam testData/rawAncientDNA.bam

The reconstructed ancient DNA fragments will be in testData/reconsAncientDNA.bam

For fastq data:

src/leeHom -f AGATCGGAAGAGCACACGTCTGAACTCCAG -s GGAAGAGCGTCGTGTAGGGAAAGAGTGTAG --ancientdna -fq1 testData/rawAncientDNA.f1.gz -fq2 testData/rawAncientDNA.f2.gz -fqo testData/outfq

The output files will have the testData/outfq* prefix.