dana

======

##1 Merge Process :

Considering 2 DNA fastq sequences:

• the first one a "classic" DNA sequence, read left to right
• the second one a complemented and reversed sequence, read right to left

1-1 Convert the complemented and reversed sequence into the "right" way.

1-2 apply drastic thresold

• Cut all the characters at the end of the first sequence with a quality score lesser than the threshold.
• Cut all the characters at the begining of the second sequence with a quality score lesser than the threshold.

1-3 Search the 10 first character of the second sequence into the first sequence

• Search from the end to the begiging of the first sequence
• if this 10 characters are found into the first sequence : try to merge the 2 sequences

2 The merge problem :

Notes d'Abigail 11/2/2016 Probleme de merge partiel:

1. choix du seuil de chevauchement minimal (m nucleotides)
2. si chevauchement(c) inferieur a m (0<c<m), remplacer les c bases du gauche du read R par des X
3. si c == 0, mettre 2 N sur la fin du read F et le debut du read R
4. dans les deux cas, coller les deux bouts

(N et X sont pareils mais comme ca on pourra differencier entre les cas 2 et 3)

Probleme de mismatch dans la partie chevauchement: Comme le F et le R viennent du meme molecule, on devrait pas avoir des differences, donc on cherche les matches exactes. On mettra donc pas un 2eme seuil. On veut jeter la sequence s'il y a des differences dans la partie chevauchee.

Exemple que tu m'as envoye: ACTATAACAGACGTATTCACAGTAGGATTAAATATCTCAAGTGCGCAAGGCGTAGACGTCGGGCG ACTATAACAGACGTATTCACAGTAGGATTAAAGATCGAAAGTGGGAAAGGAGTAG

Dans ce cas la, il faut jeter le sequence et faire un note dans le rapport dont tu m'as parle.